Bioinformatics Crash Course
Bioinformatics Crash CourseIan Misner Ph.D.Bioinformatics CoordinatorUMD Bioinformatics CoreBioinformaticsCore
The Plan Monday– Introductions– Linux and Python Hands-onTraining Tuesday– NGS Introduction– RNAseq with Sailfish (Dr. SteveMount, CBCB)– RNAseq with Tuxedo package Wednesday– Genome SequencingIntroduction– Genome Assembly and QC– Metagenomics (Dr. Mihai Pop,CBCB) Thursday– Genome Annotation– PacBio Genome Assembly (MattConte)– Review Genome Assembly andAnnotation Friday– Cloud computing and Galaxy Variant Detection and RNAseqanalysis Each day we can have a Q&Asession to find out what worksor doesn’t work as well as try toaddress any topics we haven’tcovered.BioinformaticsCore
BioinformaticsCore
atics/Workshop July 2014.pdfBioinformaticsCore
UMD Bioinformatics Core Mission: To provide userswith the bioinformaticservices, support, andeducation necessary toadvance their researchprogram. The Core has partneredwith the Division of IT toprovide the necessarycomputational resourcesneeded for thesedemanding analyses.BioinformaticsCore
Bioinformatics Core Services Raw data processing Genome and transcriptomeassembly RNAseq analysis Variant discovery Grant writing support Experimental design assistance Workflow and pipelineconstruction Custom analysesBioinformaticsCore
The Goal Allow you to conduct your own analysis. Get you comfortable using the command line. Introduce programing, HPCC’s, andDeepThought2. Learn some of the best practices withexperimental design and data analysis. Avoid common pitfalls with data processing.BioinformaticsCore
What is Bioinformatics? Interdisciplinary field combining:––––Computer scienceStatisticsMathematicsAnd Biology Lots of different areas of expertise:––––Biological programingSoftware developmentHardware developmentExperimental design Difficult for an individual to be an expert in all areas. HIGHLY COLLABRATIVE!BioinformaticsCore
What it isn’t BioinformaticsCore
What is Bioinformatics? Bioinformatics is experimental. Tools and packages are under constantdevelopment and redesign. Best practices are only just starting to bedetermined. Always do your own checking don’t assumea program is producing valid information justbecause there is some output. Garbage in Garbage out!BioinformaticsCore
Tools of the Trade Mostly open source tools.– These have published code that people can review,modify, and correct. This does not necessary mean free. Computers, lots of computers.BioinformaticsCore
BioinformaticsCore
Tools of the Trade Mostly open source tools.– These have published code that people can review,modify, and correct. This does not necessarily mean free. Computers, lots of computers. Mountains of Next Generation Sequencing(NGS) Data.BioinformaticsCore
ome.gifBioinformaticsCore
Bioinformatic Platforms Linux Command Line– Python, Perl, R, bash, etc. iPlant, iAnimal etc– Grant funded, programmer support, intuitionalsupport Galaxy– Heavy community support and funding. Commercial software Geneious, CLC, etc.BioinformaticsCore
Basic File Formats FASTAFASTQSAMBAMBioinformaticsCore
FASTA My gene some CAGACGCGCGAA Text based representation of DNA or protein sequence.First line starts with a and is the sequence description.The next line is the sequence.No standard file extention– .fa .fasta .fasBioinformaticsCore
FASTQ Fasta with quality AAAATAGATCCGTAACTTCGGG HWI-EAS225:3:1:2:854#0/1a abbbbabaabbababb [aaa N]b ab AAAACATCGAACG HWI-EAS225:3:1:2:1595#0/1a abbbababbbabbbbbbabb aaababab\aa BioinformaticsCore
Plan That covers just the basics. Today we are going to work on computer skills– Linux– PythonBioinformaticsCore
LinuxBioinformaticsCore
Python http://pythonforbiologists.com/BioinformaticsCore
Bioinformatics Crash Course Ian Misner Ph.D. Bioinformatics Coordinator UMD Bioinformatics Core . Bioinformatics!Core The Plan Monday – Introductions – Linux and Python Hands-on Training Tuesday – NGS Introduction – RNAseq with Sailfish (Dr. Steve Mount, CBCB) – RNAse
CRASH COURSE TEST PREPS: ADVANCED PLACEMENT TITLE ISBN 13 ISBN 10 PAGES PRICE AP Crash Course AP Art History Crash Course 2nd Ed. 978--7386-1200-3 -7386-1200-6 256 14.95 AP Biology Crash Course 2nd Ed. 978--7386-1099-3 -7386-1099-2 224 14.95 AP Calculus AB & BC Crash Course 2nd Ed. 978--7386-1219-5 -7386-1219-7 240 14.95
top crash-types, testers file bugs in Bugzilla and link them to the corresponding crash-type in the Socorro server. Multiple bugs can be filed for a single crash-type and multiple crash-types can be associated with the same bug. For each crash-type, the Socorro server provides a crash-type summary, i.e.,
6 Definitions of police reported casualty types: Casualty Crash - crash where at least one fatality, serious injury or minor injury occurs. Casualty - A fatality, serious injury or minor injury. Fatal Crash - A crash for which there is at least one fatality. Fatality - A person who dies within 30 days of a crash as a result of injuries sustained in that crash.
SECTION-A: Attempt any five questions. SECTION-B: Attempt any five questions. SECTION–A Short Answer type Questions: (60-80 Words) 5 5 25 Marks 1. What is the role of internet in bioinformatics? 2. How bioinformatics assist in drug designing? 3. Write a short note on Internet Protocol (IP). 4. What is Pattern mining? 5.
volumes of biological information in bioinformatics database. They also provide some bioinformatics tools for database search and data acquire. With the explosion of sequence information available to researchers, the challenge facing bioinformatics and computational biologists is to aid in biomedical researches and to invent efficient toolkits.
tronics, Physics, Statistics, or Business Informatics. 8 LUM RAMABAJA Bachelor’s Student in Bioinformatics ‘Bioinformatics is a truly interesting field. The program has inspired me to apply what I have learned and help people by starting a company that diagnoses malaria.’ To The Point KRISTINA PREUER BSc MSc Graduate in Bioinformatics
Bioinformatics, Stellenbosch University Many bioinformatics tools and resources are available on the command-line interface These are often on the Linux platform (or other Unix-like platforms such as the Mac command line). They are essential for many bioinformatics and genomics applications.
Abrasive Water Jet Machining (AWJM) is the non-traditional material removal process. It is an effective machining process for processing a variety of Hard and Brittle Material. And has various unique advantages over the other non-traditional cutting process like high machining versatility, minimum stresses on the work piece, high flexibility no thermal distortion, and small cutting forces .
