Targeting The NAD Salvage Pathway Suppresses APC

1y ago
23 Views
1 Downloads
4.13 MB
17 Pages
Last View : 12d ago
Last Download : 6m ago
Upload by : Bria Koontz
Transcription

Ye et al. Cell Communication and (2020) 18:16RESEARCHOpen AccessTargeting the NAD salvage pathwaysuppresses APC mutation-driven colorectalcancer growth and Wnt/β-catenin signalingvia increasing Axin levelChenyang Ye1†, Lina Qi1†, Xiaofen Li1,2†, Ji Wang3,4, Jiekai Yu1, Biting Zhou1, Cheng Guo1, Jiani Chen1 andShu Zheng1,5*AbstractBackground: The role and mechanism of the nicotinamide adenine dinucleotide (NAD ) salvage pathway incancer cell proliferation is poorly understood. Nicotinamide phosphoribosyltransferase (NAMPT), which convertsnicotinamide into NAD , is the rate-limiting enzyme in the NAD salvage pathway. Here, we assessed the role ofNAMPT in the proliferation of colorectal cancer.Methods: Real-time PCR, immunohistochemistry, western blotting, and analyses of datasets from Oncomine andGene Expression Omnibus were conducted to assess the expression of NAMPT at the mRNA and protein levels incolorectal cancer. The Kaplan Meier plotter online tool was used to evaluate the prognostic role of NAMPT.Knockdown of NAMPT was performed to assess the role of NAMPT in colorectal cancer cell proliferation andtumorigenesis both in vitro and in vivo. Overexpression of NAMPT was used to evaluate impact of NAMPT oncolorectal cancer cell proliferation in vitro. NAD quantitation, immunofluorescence, dual luciferase assay andwestern blot were used to explore the mechanism of colorectal cancer proliferation. Transwell migration andinvasion assays were conducted to assess the role of NAMPT in cell migration and invasion abilities of colorectalcancer cells.Results: Our study indicated that the inhibition of NAMPT decreased proliferation capacity of colorectal cancer cellsboth in vitro and in vivo. Conversely, overexpression of NAMPT could promote cell proliferation in vitro. NAMPTinhibition induced β-catenin degradation by increasing Axin expression levels; this resulted in the inhibition of Wnt/β-catenin signaling and cell proliferation in colorectal cancer. The addition of nicotinamide mononucleotide, theenzymatic product of NAMPT, effectively reversed β-catenin protein degradation and inhibited growth. Similarly, theknockdown of Axin also decreased the cell death induced by the inhibition of NAMPT. In addition, we showed thatcolorectal cancer tissues harbored significantly higher levels of NAMPT than the levels harbored by paired normaltissues, especially in colorectal cancer stages I and II. And the overexpression of NAMPT was associated withunfavorable survival results.(Continued on next page)* Correspondence: zhengshu@zju.edu.cn†Chenyang Ye, Lina Qi and Xiaofen Li contributed equally to this work.1Cancer Institute (Key Laboratory of Cancer Prevention and Intervention,China National Ministry of Education), the Second Affiliated Hospital, Schoolof Medicine, Zhejiang University, Zhejiang 310009, Hangzhou, China5Reseach Center for Air Pollution and Health, School of Medicine, ZhejiangUniversity, Zhejiang 310009, Hangzhou, ChinaFull list of author information is available at the end of the article The Author(s). 2020 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication o/1.0/) applies to the data made available in this article, unless otherwise stated.

Ye et al. Cell Communication and Signaling(2020) 18:16Page 2 of 17(Continued from previous page)Conclusions: Our findings reveal that NAMPT plays an important role in colorectal cancer proliferation via Wnt/βcatenin pathway, which could have vital implications for the diagnosis, prognosis and treatment of colorectalcancer.Keywords: NAD , NAMPT, FK866, Colorectal cancer tumors, Proliferation, Wnt/β-catenin,BackgroundColorectal cancer (CRC) is the third most common diagnosed and death-causing cancer in both men andwomen in the United States in 2019 [1]. Despite improvements to diagnostic techniques and therapeuticsover the last two decades, less than 20% of newlydiagnosed metastatic colorectal cancer patients survivemore than 5 years [2]. This situation highlights thepressing need to find better biomarkers for early stagedetection and optimal therapeutic targets for the controlof CRC progression.CRC cells require specific adaptations of cellular metabolism to support high proliferative capacity [3, 4].Since NAD is a vital component that participates inmultiple aspects of cellular metabolism, a higher basalNAD turnover is required to meet enhanced metabolicrequirements of CRC cells [5–7]. In cancer cells setting,the biosynthesis of NAD is mainly via the salvage pathway from nicotinamide (NAM), nicotinic acid (NA) andNAM riboside (NR) rather than via the de novo pathwayfrom tryptophan [6]. Nicotinamide phosphoribosyltransferase (NAMPT), also known as visfatin or pre-B cell enhancing factor, is the rate-limiting enzyme in the NAD salvage pathway. NAMPT converts 5-phosphoribosyl-1pyrophosphate (PRPP) and nicotinamide (NAM) intonicotinamide mononucleotide (NMN) [8–10]. Then,NMN is converted into NAD by NAM mononucleotideadenylyltransferases [11, 12]. In addition to important effects on cellular metabolism, NAMPT has also beenfound to participate in a variety of oncogenic cellularprocesses, including tumor proliferation, apoptosis, metastasis, inflammation, DNA repair and angiogenesis[13–19]. NAMPT also serves as a biomarker and prognostic indicator in cancer [11, 14]. However, the function and mechanism of NAMPT in CRC remains to beclarified.According to the comprehensive and integrated analysis of the human CRC genome, the Wnt/β-catenin signaling pathway is one of the most important pathwaysin the initiation and progression of CRC [20]. Currently,the Wnt/β-catenin signaling pathway lacks druggablemolecular targets, which has hampered the developmentof therapeutic drugs targeting this pathway. It is unknown whether NAMPT regulates colorectal cancerproliferation through Wnt/β-catenin signaling pathway.If NAMPT could regulate Wnt/β-catenin pathway, thentargeting NAMPT such as using its inhibitor FK866could be a potential therapeutic option to retard tumorgrowth.In this study, we discovered a novel mechanism of theregulation of CRC proliferation by NAMPT. NAMPTwas found to be significantly overexpressed in the earlystages of CRC (stages I and II) through proteomics andexpression microarrays compared to the expression inadjacent normal tissues. Thus, we presumed thatNAMPT might contribute to proliferation. Next, in vitroand in vivo experiments confirmed our hypothesis.Interestingly, we found that the Wnt/β-catenin pathwaycontributed to this process. Consequently, NAMPT regulated cell proliferation by activating the Wnt/β-cateninpathway and could be used as a biomarker for earlystage CRC screening and a drug target after furtherresearch.MethodsOncomine database analysisThe expression levels of NAMPT gene in CRC and adjacent normal tissues were analyzed using Oncomine, acancer microarray database and web-based data miningplatform from genome-wide expression analyses [21,22]. The mRNA expression level in cancer tissues compared to the noncancerous control tissues was obtainedas the parameters of p value 0.001, fold change 2,and gene ranking in the top 10%.Gene expression from TCGAThe Cancer Genome Atlas (TCGA) gene expressionprofile of NAMPT was obtained from a web portalUALCAN [23]. In UALCAN (http://ualcan.path.uab.edu/), the clinical data for patients with colon cancerand Level3 TCGA RNA-seq data (including raw readcount and scaled estimate for each sample) for primarytumors and matched normal samples were downloadedusing TCGA assembler [24]. For each gene, transcriptper million values were obtained by multiplying thescaled estimate by 1,000,000. Boxplots were generatedby use of R (https://cran.r-project.org/).The Kaplan-Meier plotter databaseThe prognostic merit of gene mRNA expression was appraised by an online database, Kaplan-Meier Plotter(www.kmplot.com) [25], which included gene expression

Ye et al. Cell Communication and Signaling(2020) 18:16data and survival information of clinical CRC patientsfrom Gene Expression Omnibus (GEO) and the CancerGenome Atlas (TCGA) databases. To analyze the overallsurvival (OS) and relapse free survival (RFS) of patientswith CRC patient samples were split into two groups bymedian expression (high vs. low expression) andassessed by a Kaplan-Meier survival plot, with the hazard ratio (HR) with 95% confidence intervals (CI) andlog-rank p value.Sample collection and patient characteristicsFor immunohistochemistry (IHC) analysis, the CRC tissue microarray (TMA) including paired CRC and adjacent normal tissues surgically collected from 50 patients,were collected from Wuhan Servicebio technology company. For mRNA and protein analyses, 20 pairs of CRCand adjacent normal tissues were surgically obtainedfrom the Second Affiliated Hospital, Zhejiang UniversitySchool of Medicine, and frozen at 80 C. Written, informed consent was obtained from each patient. TheEthics Committee of the Second Affiliated Hospital atZhejiang University, School of Medicine approved thisstudy.IHC staining and semiquantitative analysisPage 3 of 17mixture (Roche Applied Science). Nuclear and cytoplasmic protein extracts were prepared using a Nuclear andCytoplasmic Protein Extraction Kit (Beyotime). Proteinextracted from the cells or from fresh-frozen tissues wasloaded and separated by 10% SDS-polyacrylamide gelelectrophoresis (SDS-PAGE). Then, the proteins weretransferred onto polyvinylidene fluoride (PVDF) membranes by electrophoresis and were incubated with theprimary antibodies. Immunoreactive bands were detected by chemiluminescence using correspondinghorseradish peroxidase (HRP)-conjugated secondaryantibodies and enhanced chemiluminescence (ECL) detection reagents. Gray intensity analysis of the westernblot images was conducted using ImageJ software. Then,the relative protein abundance was determined. The primary antibodies used for western blot include the following: anti-NAMPT (Cell Signaling Technology, #61122), anti-GAPDH (Cell Signaling Technology, #5174), anti-β-catenin (Cell Signaling Technology, #8480), anti-cyclin D1 (Cell Signaling Technology, #2978), and anti-Axin (Cell Signaling Technology, #2087).Quantitative reverse transcription-polymerase chainreaction (qRT-PCR)CRC TMA was heated, deparaffinized and treated withcitrate antigen repair buffer (pH 6.0) for antigen repairwith 3% hydrogen peroxide to block endogenous peroxidase activity and 3% BSA for serum blocking. The TMAwas incubated with an anti-NAMPT primary antibody(1:250, Abcam, ab45890) and with the coordinating secondary antibody. Staining was displayed with DAKODBA solution. Harris hematoxylin was used to restainthe nucleus, and TMA was dehydrated by alcohol. Thestained TMA was scanned using the Pannoramic Midiand was analyzed using the Pannoramic Viewer (3D Histech) and Quant center. The software automaticallyidentified and scored all brown staining on the tissuesection as follows: dark brown 3, brown yellow 2,light yellow 1, blue nucleus 0, and the software evaluated the extent of stained cells (0–5% 0; 5–25% 1;26–50% 2; 51–75% 3 and 76–100% 4). The finalscore was determined by multiplying the intensity scoreand the score for the extent of stained cells, generating ascore that ranged from 0 to 12. The staining results werecategorized into negative (score 0; ), low (score 1–4; ),moderate (score 5–8; ), and high (score 9–12; ).The results were evaluated by two independentpathologists.Total RNA was extracted from fresh-frozen CRC tissuesor CRC cells. The Takara PrimeScript RT Master MixKit (Takara, RR036Q) was used for reverse transcription.The SYBR Premix Ex Taq II Kit (Takara, RR820A) andApplied Biosystems 7500 Fast Real-Time PCR Systemwere applied for real-time PCR analysis. Experimentswere carried out in triplicate, and GAPDH was used asthe loading control. The forward primer sequence ofNAMPT was AATGTTCTCTTCACGGTGGAAAA (5′to 3′), and the reverse primer sequence was ACTGTGATTGGATACCAGGACT (5′ to 3′). The forward primer sequence of GAPDH was ATCCCATCACCATCTTCCAG (5′ to 3′), and the reverse primer sequencewas TGAGTCCTTCCACGATACCA (5′ to 3′). TheΔΔCt method was applied to evaluate the mRNA relative expression level.Subcellular protein fractionation and western blottinganalysisTreatment of NMN or FK866Total protein extracts were prepared using RIPA buffer(Beyotime) in the presence of a proteinase inhibitorCell cultureThe LoVo, SW480, SW620, RKO, HCT116, HT29 andDLD1 cell lines were purchased from ATCC and werecultured in DMEM at 37 C in 5% CO2. The culturemedium was supplemented with 10% FBS (HyClone),100 U/mL penicillin and 100 mg/mL streptomycin.The inhibitor FK866 (cat # S2799) and NMN (cat #S5259) were obtained from Selleck Chemicals. LoVo andRKO cells were seeded into 96-well culture plates at

Ye et al. Cell Communication and Signaling(2020) 18:161000 cells/well and were allowed to attach for 24 h in anincubator before treatment with FK866 or NMN.NAD quantitationMeasurement of NAD was conducted using SIGMANAD/NADH Quantitation kit (MAK037) following themanufacturer protocol. Briefly, 1 105 cells harvestedfor total NAD extraction and quantification. The NADCycling Enzyme Mix recognizes NAD and NADH instead of NADP or NADPH. Concentration of NAD total(NAD NADH) was measured by absorbance at OD450 nm. The NAD concentration was calculated bysubtracting the NADH values from NADtotal.Stable gene knockdown and overexpression usinglentiviral gene deliveryAccording to published papers and results from the blasttool in the NCBI database, we used the following targetsequences: NAMPT (5-′ GAGTGTTACTGGCTTACAA3′) [13], Axin (5′- GAGGAAGAAAAGAGAGCCA-3′)[26], and a scrambled sequence (5′- GAGTGTTACGGGGTTCCAG-3′). These sequences were cloned intoGV248/GV307 vectors (GeneChem, Shanghai, China). Allplasmids were transfected into 293 T cells together withthe Lentivector Expression System (GeneChem, Shanghai,China) to produce lentivirus. These specific shRNAs werepackaged into lentiviruses by GeneChem Inc. ForNAMPT overexpression, the published method was used[13]. For the infection, the target cells were cultured at100,000 cells per well in 6-well plates, cocultured with2.5 106 Tu virus in the presence of 5 mg/ml polybreneand standard medium for 13 h, and then cultured withfresh medium. After 72 h of transfection, the cells were selected via incubating with 1 μg/ml puromycin for 1 week.We utilized Western blot analyses to confirm the expression of the target genes.Cell viability analysisCell Counting Kit-8 (CCK-8, Dojindo, Japan, CK04)) wasutilized to evaluate the cell proliferation. The experiments were performed according to the manufacturer’sprotocol. Briefly, 1 103 cells were seeded into a 96-wellplate containing 100 μL of completed culture mediumper well that was incubated in a 37 C incubator. Culturemedium was used as a blank control. The cell proliferation was evaluated every day for 5 days after plating.CCK-8 solution (10 μL) was added to each well, andthen, the plate was incubated with the cells in the 37 Cincubator for 3 h. An optimal density (OD) value of 450nm was used to measure the cell proliferation. The meanand SD were calculated from three independent assays.Page 4 of 17Cell colony formation assayCell colony formation experiments were performed toreflect anchorage-independent cell growth. Approximately 1000 cells were seeded into a 6-well plate containing complete culture medium that was incubated ina 37 C incubator. Colonies consisting of more than 50cells after 2 weeks were counted.Immunofluorescence assayThe cells seeded onto glass slides were fixed in 4% formaldehyde for 10 min and blocked with PBS-T (PBS 0.1% Tween 20) containing 1% BSA and 0.1% Triton X100 for 1 h at room temperature. Next, anti-visfatin(Abcam, ab45890) and anti-Ki-67 (CST, Mouse mAb#9449) antibodies were diluted in blocking buffer according to the manufacturer’s recommendation andwere incubated with cells at 4 C overnight. After washing with PBS-T three times for 5 min each, Alexa Fluor488-labeled (Abcam, ab150073) and Alexa Fluor 568labeled (Abcam, ab175472) secondary antibodies werediluted in blocking buffer according to the manufacturer’s recommendation and were incubated with thecells at room temperature for 1 h. Before adding DAPI,the slides were washed with PBS-T three times for 5min each. A confocal microscope (Zeiss) was used fortaking photographs.Flow cytometry for apoptosis analysisTrypsin (0.25%) without EDTA was used to harvest cells(1 106–107 cells) in a 6-well culture flask (in triplicatefor experiments). The Annexin V-FITC/PI Apoptosis Kitused in this experiment was manufactured by Lianke(China, Cat#: AP101–30-kit). The collected cells werewashed twice with PBS and were resuspended in 500 μlpre-cooled 1x Binding Buffer. Then, 5 μl Annexin VFITC and 10 μl PI were added to the cell suspension andvortexed softly. The cells were incubated for 5 min atroom temperature in the dark. The cells were analyzedby flow cytometry (FACSCanto II; BD Biosciences, SanJose, CA, USA) directly without washing. The cellstreated with 0.1% DMSO were used for parameteradjustment.Dual luciferase assayCells were seeded in 24-well plates and transfected thefollowing day with a total of 0.6 μg of DNA/well (0.5 μgof TOPFLASH, and 0.1 μg of thymidine kinase promoterRenilla). The lysates were collected 48 h posttransfection and used with the dual luciferase reportersystem (Promega). Firefly and Renilla luciferase activitywas measured in a luminometer. Normalized dataexpressed in relative luciferase units was averaged fromtriplicate assays, and the error bars reflect the standarddeviations.

Ye et al. Cell Communication and Signaling(2020) 18:16Transwell migration and invasion assaysFor migration assays, cells were seeded in the upperchamber of a 6.5-mm Transwell with 8.0-μm pore polycarbonate membrane inserts (Corning, USA) in 200 μl ofserum-free medium containing for 48 h at 37 C.Complete growth medium with 20% FBS was placed inthe bottom compartment as a chemoattractant. After incubation, nonmigrated cells were wiped off from theupper surface using cotton swabs. The migrated cells onthe lower surface were fixed with 4% paraformaldehydeand stained using crystal violet. Five random fields ofmigrated cells were imaged at a magnification of 200 ;migrated cells were quantified using ImageJ analysissoftware. For invasion assays, cells were seeded in theupper chamber of a 6.5-mm Transwell with 8.0-μm PETmembrane precoated with Matrigel (Corning, USA) in200 μl of serum-free medium for 72 h at 37 C. Invadedcells were fixed, stained, imaged, and counted as described above.Xenografts in nude miceAnimal experiments were conducted according to theAnimal Study Guidelines of Zhejiang University. Fiveweek-old female nude mice (BALB/C) were used for theanimal study. To construct the subcutaneous tumorxenograft mouse model, 5 106 tumor cells wereinjected subcutaneously at the costal margin. The size ofthe xenograft tumor was measured every 3 days. Themice were sacrificed 25 days later, and the subcutaneousxenograft tumors were dissected and weighed. Portionswere immediately frozen in liquid nitrogen for the following extraction of protein or were fixed in 10% buffered formalin for immunohistochemistry staining.Statistical analysisSPSS Statistics 23.0 (IBM, Armonk, NY, USA) was usedto conduct statistical analyses. The statistical tests weretwo-sided, and p 0.05 was considered statistically significan

the Wnt/β-catenin signaling pathway lacks druggable molecular targets, which has hampered the development of therapeutic drugs targeting this pathway. It is un-known whether NAMPT regulates colorectal cancer proliferation through Wnt/β-catenin signaling pathway. If NAMPT could regulate

Related Documents:

May 02, 2018 · D. Program Evaluation ͟The organization has provided a description of the framework for how each program will be evaluated. The framework should include all the elements below: ͟The evaluation methods are cost-effective for the organization ͟Quantitative and qualitative data is being collected (at Basics tier, data collection must have begun)

UC Pathway Funds. UC Pathway Income Fund UC Pathway Fund 2020 UC Pathway Fund 2025. UC Pathway Fund 2030. UC Pathway Fund 2035 UC Pathway Fund 2040 UC Pathway Fund 2045. UC Pathway Fund 2050. UC Pathway Fund 2055 UC Pathway Fund 2060. UC Pathway Fund 2065. CORE FUNDS - 17.0 billion Bond and Stock Investments

TARGET DATE FUNDS - 9.1 billion UC Pathway Funds UC Pathway Income Fund UC Pathway Fund 2020 UC Pathway Fund 2025 UC Pathway Fund 2030 UC Pathway Fund 2035 UC Pathway Fund 2040 UC Pathway Fund 2045 UC Pathway Fund 2050 UC Pathway Fund 2055 UC Pathway Fund 2060 UC Pathway Fund 2065 CORE FUNDS - 12.9 billion Bond and Stock Investments Bond .

UC Pathway Income Fund UC Pathway Fund 2015 UC Pathway Fund 2020 UC Pathway Fund 2025 . UC Pathway Fund 2030 UC Pathway Fund 2035 UC Pathway Fund 2040 UC Pathway Fund 2045 . UC Pathway Fund 2050 UC Pathway Fund 2055 UC Pathway Fund 2060 . CORE FUNDS - 13.7 billion Bond and Stock Investments . Bond Investments Short-Term UC Savings Fund

transferase (Qprt), a key enzyme in the de novo path-way, has no effect in the NAD levels in murine tissues, including the liver [41]. These results indicate that NAD synthesis in mammalian cells largely de-pends on the salvage pathway. However, a recent study has demonstrated that the de novo pathway contributes to synthesis and maintenance of NAD

On an exceptional basis, Member States may request UNESCO to provide thé candidates with access to thé platform so they can complète thé form by themselves. Thèse requests must be addressed to esd rize unesco. or by 15 A ril 2021 UNESCO will provide thé nomineewith accessto thé platform via their émail address.

̶The leading indicator of employee engagement is based on the quality of the relationship between employee and supervisor Empower your managers! ̶Help them understand the impact on the organization ̶Share important changes, plan options, tasks, and deadlines ̶Provide key messages and talking points ̶Prepare them to answer employee questions

Chính Văn.- Còn đức Thế tôn thì tuệ giác cực kỳ trong sạch 8: hiện hành bất nhị 9, đạt đến vô tướng 10, đứng vào chỗ đứng của các đức Thế tôn 11, thể hiện tính bình đẳng của các Ngài, đến chỗ không còn chướng ngại 12, giáo pháp không thể khuynh đảo, tâm thức không bị cản trở, cái được

Ardent Americas LLC Ballard Marine Construction Diving Service Salvage Donjon Marine Co., Inc. Foss Maritime Company Global Diving & Salvage, Inc. Laredo Construction, Inc. Resolve Marine Group SAAM S.A. SMIT Salvage Americas, Inc. T&T Salvage, LLC AMERICAN

the Wnt/β-catenin pathway may be involved in the pathophysiology of endometriosis. This is a review of the literature focused on the aberrant activation of the Wnt/β-catenin pathway in patients with endometriosis, and on how targeting the Wnt/targeting pathway may be a potentially effecti

Ballard did not claim salvage rights to the vessel, and later published the coordinates of the wreck, effectively inviting other entities to make salvage claims. The pro-salvage argument was equally comp

potentially apply to auto salvage operations, depending on the types of activity conducted. Some regulations that are commonly relevant to auto salvage facilities focus on the following topics. Air Regulations . Activities, Operations and Equipment . Operations and activities that could occur at auto salvage facilities have the potential to release

Le genou de Lucy. Odile Jacob. 1999. Coppens Y. Pré-textes. L’homme préhistorique en morceaux. Eds Odile Jacob. 2011. Costentin J., Delaveau P. Café, thé, chocolat, les bons effets sur le cerveau et pour le corps. Editions Odile Jacob. 2010. Crawford M., Marsh D. The driving force : food in human evolution and the future.

Le genou de Lucy. Odile Jacob. 1999. Coppens Y. Pré-textes. L’homme préhistorique en morceaux. Eds Odile Jacob. 2011. Costentin J., Delaveau P. Café, thé, chocolat, les bons effets sur le cerveau et pour le corps. Editions Odile Jacob. 2010. 3 Crawford M., Marsh D. The driving force : food in human evolution and the future.

MARCH 1973/FIFTY CENTS o 1 u ar CC,, tonics INCLUDING Electronics World UNDERSTANDING NEW FM TUNER SPECS CRYSTALS FOR CB BUILD: 1;: .Á Low Cóst Digital Clock ','Thé Light.Probé *Stage Lighting for thé Amateur s. Po ROCK\ MUSIC AND NOISE POLLUTION HOW WE HEAR THE WAY WE DO TEST REPORTS: - Dynacó FM -51 . ti Whárfedale W60E Speaker System' .

Glossary of Social Security Terms (Vietnamese) Term. Thuật ngữ. Giải thích. Application for a Social Security Card. Đơn xin cấp Thẻ Social Security. Mẫu đơn quý vị cần điền để xin số Social Security hoặc thẻ thay thế. Baptismal Certificate. Giấy chứng nhận rửa tội

More than words-extreme You send me flying -amy winehouse Weather with you -crowded house Moving on and getting over- john mayer Something got me started . Uptown funk-bruno mars Here comes thé sun-the beatles The long And winding road .

Phần II: Văn học phục hưng- Văn học Tây Âu thế kỷ 14- 15-16 Chương I: Khái quát Thời đại phục hưng và phong trào văn hoá phục hưng Trong hai thế kỉ XV và XVI, châu Âu dấy lên cuộc vận động tư tưởng và văn hoá mới rấ

Food outlets which focused on food quality, Service quality, environment and price factors, are thè valuable factors for food outlets to increase thè satisfaction level of customers and it will create a positive impact through word ofmouth. Keyword : Customer satisfaction, food quality, Service quality, physical environment off ood outlets .

opinions about the courts in a survey conducted by the National . criminal justice system, and that black women are imprisoned at a rate seven times greater than white women. The report indicates there has been an increase in their incarceration rate in excess of 400% in recent years. Further, three-fourths of the women, according to the report, were mothers, and two-thirds had children .