2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY
2020 POLITICAL CONTRIBUTIONSAND LOBBYING ACTIVITY REPORT950234 03/21
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTTABLEOF CONTENTSOpening Letter from David Cordani, President and CEO3Overview and Governance4Political Contributions5Corporate Contributions6Lobbying Activity and Priorities12Trade Association Memberships13CignaPAC Annual Report14About CignaPAC15Board Oversight15CignaPAC Contribution Strategy16Cigna PAC Contributions17Cigna Missouri PAC Contributions43Cigna New York PAC Contributions442
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTThe COVID-19 pandemic took a heavy toll around the globethroughout 2020, in both lives lost and lives disrupted. Cignaled our industry’s response by taking decisive action toeliminate cost as a barrier to COVID-19 testing and treatmentand by expanding access to care. We also launched ourCustomer Protection Program to further safeguard customersfrom unexpected costs for COVID-19 care, and we developedour COVID-19 High-Risk Dashboard to support employers’ safereturn-to-work plans.As we worked to make a difference throughout the crisis, wealso continued to advance our vision to transform the healthcare system by making it more affordable, predictable andsimple for those we serve. Our efforts were not only evidentthrough the products and services we brought to market in2020 but also through our advocacy efforts in the area ofpublic policy.Cigna is committed to improving the sustainability of thecurrent health care system through active, principle-basedengagement with policy makers on both sides of the aisle. Wesupport proposals that address key issues such as reducingcost, improving access and affordability, and promotingtransparency that is meaningful and actionable for consumers.In Cigna’s 2020 Political Contribution and Lobbying ActivityReport, you’ll find information about our engagement throughpolitical contributions and advocacy, including the annualreport of the Cigna Political Action Committee (CignaPAC).As 2021 brings political transitions at all levels of government,Cigna remains committed to sharing our perspective andinsights to help inform the debate over the nation’s health caresystem. It is important work that we believe is critical to thefulfillment of our mission – to improve the health, well-beingand peace of mind of those we serve. Table of ContentsDavid M. CordaniPresident andChief Executive Officer3
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTOVERVIEWAND GOVERNANCECigna takes its engagement in the legislative, regulatory and public policy areas very seriously,approaching all our efforts with care and integrity.There are two major components of Cigna’s political activity:1. Political contributions2. Lobbying effortsThis report is organized to provide information on both of these activities.As Cigna engages in political activity, it adheres to strict governance standards designed toensure alignment with Cigna’s mission, values and strategic goal. All political contributions thatare made directly by the Company must be made in accordance with Political Activity Policy,which requires, among other things, oversight of decisions at the highest corporate level.Political contributions that are made through CignaPAC are reviewed and approved by theCignaPAC Board of Directors, composed of executive-level Cigna leadership and other businessleaders, in accordance with CignaPAC contribution guidelines.With respect to the Company’s lobbying activities, the Vice President of Global Public Policyand Federal Government Affairs and the Vice President of State Government Affairs reportdirectly to the General Counsel and review lobbying efforts with Cigna’s enterprise leadership,including the Chief Executive Officer, on a regular basis. Additionally, all memberships in tradeassociations are reviewed by the General Counsel and the Chief Executive Officer.The Company also maintains an Enterprise Risk Management function. This company-wideinitiative involves the Board of Directors (and its committees), Cigna’s management, Cigna’sGeneral Auditor and Chief Risk Officer, and Cigna’s internal audit function. Together, they workin an integrated effort to (1) identify, assess, prioritize and monitor (as each of their rolesdictates) a broad range of risks (e.g., financial, operational, business, compliance, reputational,governance and managerial), and (2) formulate and execute plans to monitor and, to the extentpossible, mitigate the effect of those risks.Within this enterprise risk framework, the Corporate Governance Committee of Cigna’s Board ofDirectors has oversight of and evaluates any material financial, legal, reputational or other risksassociated with Cigna’s corporate political spending and lobbying activities. In addition, theCorporate Governance Committee biannually reviews compliance with Cigna’s Political ActivityPolicy, including the contributions made under that policy by the Company and CignaPACduring the previous year, and annually reviews lobbying expenses and trade associationmemberships. Table of Contents4
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORT5POLITICALCONTRIBUTIONSCigna regularly supports federal, state and local officials,candidates, parties, and other politically oriented groups andorganizations that the Company believes can advance itsmission, business objectives and goals, including principlesor issues that support Cigna’s vision for a sustainable healthcare system. As Cigna considers making politicalcontributions, it is always guided by the Company’s mission,values and strategy, demonstrating an eagerness to workwith officials of various political and philosophical beliefsand without regard for the private political preferences ofits executives.Cigna makes political contributions in two ways:(1) through corporate contributions and (2) throughCignaPAC. Cigna has strict standards in place governing itspolitical giving activity, and all its contributions are made inaccordance with applicable state and federal laws. Inaddition, the Company keeps the work of CignaPAC separatefrom other Company giving. Accordingly, this section of thereport provides information specific to Cigna’s directcorporate contributions, and the CignaPAC Annual Report atthe end of the report provides contribution details fordisbursements made through CignaPAC.All of Cigna’s government relations engagements, includingpolitical contributions, are intended to be constructive andnonpartisan with an aim to advancing public policies that webelieve support the greater societal good of a moreaffordable, predictable and simple health care system for allpatients and communities. Cigna also stands for diversity,inclusion, equity and equality; our public policy activities arean extension of that commitment. Table of Contents
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTCORPORATE CONTRIBUTIONSThe Political Activity Policy authorizes the use of corporate funds in certain states where corporationsare permitted to contribute to state election campaigns. Cigna made the following corporatecontributions to state-level CACACACACACACACACACACATitleAssm.Sen.Sen.Atty. m.CountySupervisorAssm.Assm. Table of ContentsFirst nnonMelissaSydneyConnieMoniqueChadHollyLast DDRDAmount 1,000 1,000 1,000 2,500 1,000 1,000 1,000 1,000 1,000 1,500 1,500 2,000 1,500 2,500 1,000 1,000 1,000 1,000 1,000 2,000 1,000 1,500 1,000 1,000 2,000 1,500AdrinPatrickNazarianO'DonnellDD 1,000 1,0006
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY Rep.Sen.Rep.Sen.Rep.Sen.Rep.Rep.Atty. n.Rep.Rep.Rep.Rep. Table of ContentsFirst ulaMichaelLast RRAmount 2,000 1,000 1,000 1,000 1,000 3,000 1,000 2,000 2,000 200 200 250 1,500 250 200 200 250 200 250 200 200 1,500 200 250 200 200 250 1,000 1,250 500 750 250 500 1,250 500 250 1,000 2507
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY p.Rep.Rep.Rep.Sen.Sen.Rep.Atty. ep.Sen.Sen.Sen.Rep. Table of ContentsFirst NameKathyLarryKyleJasonKatrinaRonnieC. StephenSeanRonnieTomMichaelC. BradleyRussellWilliamNikkiJohnJ. StuartJacobCurtisBradyLast nkSeevers RDDDRDDRRRRRRRRRRRRDDDRDRRRRDDRDRRRRRAmount 250 250 500 250 500 500 250 750 750 250 500 500 250 250 250 1,000 250 500 2,000 500 250 1,000 500 500 1,000 500 500 500 500 500 500 500 500 500 750 500 500 2508
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY n.Rep.Atty. p.Rep.Rep.Rep.Rep.Rep.Sen.Sen. Table of ContentsFirst st RRRRRDDDDRDDDDDRAmount 250 250 500 1,500 750 250 250 500 500 500 500 500 500 250 500 5,000 500 500 500 1,000 250 500 250 500 1,000 1,000 1,000 1,000 500 1,000 1,000 1,000 1,000 1,000 1,0009
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY Rep.Rep.Rep. Table of ContentsFirst PatMy-LinhAmyJimJ.T.AlexLast coxYbarraPartyRDDDDRRDRDDDDRRRAmount 1,000 1,000 1,000 1,000 1,000 1,000 1,000 1,000 500 1,000 1,000 1,000 1,000 1,000 1,000 1,00010
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTCigna also made the following corporate contributions to state party committees and other state-levelpolitical action committees and OUTUTUTUTWAWAWAWAWAWAOrganizationCalifornia Democratic Party (Non-federal)California Republican Party (Non-federal)Dr. Richard Pan Senate 2018 Officeholder AccountJohn Bel Edwards for LA Leadership PAC LLCLakeshore Action Fund (527)Magna Carta Inc. (527)Michigan Opportunity Fund (527)Mid-Michigan Strong (527)Reinvent Michigan Fund (527)Road to Michigan Fund (501c4)House Republican Campaign CommitteeHouse Victory CommitteeMajority ForwardMissouri Senate Campaign CommitteeMO Opportunity PACUniting Missouri PACSenDemPACUtah House Dems Leadership CouncilUtah House Republican Election CommitteeUtah Republican Senate Campaign CommitteeHouse Democratic Campaign CommitteeHouse Republican Organizational CommitteeSenate Republican Campaign CommitteeWashington Senate Democratic CampaignSenate Republican Campaign CommitteeWashington Senate Democratic CampaignPartyDRDDRRDRDDRDDRRRDDRRDRRDRDAmount 2,000 2,000 2,500 1,500 1,000 1,000 1,000 1,000 1,000 5,000 10,000 5,000 5,000 10,000 5,000 10,000 500 500 500 500 1,000 1,000 1,000 1,000 1,000 1,000In addition, Cigna made the following corporate contributions in support of our advocacy efforts.OrganizationDemocratic Governors AssociationRepublican Governors AssociationDemocratic Attorneys General AssociationRepublican Attorneys General AssociationPartyDRDRAmount 125,000 125,000 65,000 65,000Cigna did not make any independent expenditures or corporate contributions in support of ballotmeasures in 2020. Table of Contents11
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORT12LOBBYING ACTIVITYAND PRIORITIESCigna’s State and Federal Government Affairs andGlobal Public Policy teams lead Cigna’sengagement in complex policy matters whilemaintaining the company’s commitment to beinga thoughtful and constructive participant in publicdialogues around the world. Members of the teamrepresent Cigna’s business interests in the U.S.Congress, in the Executive Branch, and withnational thought leaders, trade associations andstate legislatures to advance constructivesolutions and reorient others that we believe will notachieve the goals of affordable, high-quality coveragefor all Americans.Every American deserves access to affordable,quality health care. It is a critical time for us toconstructively engage in meaningful andsustained advocacy to help improve the Americanhealth care system to be more affordable,predictable and simple for all those we serve. Asdebates on health care continue, especially in lightof the COVID-19 pandemic, we remain committedto addressing today’s dynamic health careenvironment through active, nonpartisanengagement with policy makers.In 2020, Cigna focused its advocacy efforts onadvancing public policies that we believe bestachieve those goals. Such policies includeaddressing barriers to affordability, access andflexibility for patients, employers and providers asa result of the COVID-19 pandemic; expanding theemployer-based market’s ability to provideinnovative, value-based health coverage; aligningincentives and information around the patient tohelp support their health care and value-basedcare decisions; growing opportunities for publicprivate partnerships; and ensuring policies enablea more integrated, equitable service model andwhole person health.For example, we support proposals that putindividuals at the center of health care delivery Table of Contentsand those that address underlying cost drivers ofhealth care that continue to grow at unsustainablelevels. While some policy makers are calling for ashift from our current health care system to onethat is government controlled (e.g., Medicare forAll, public option or Medicare buy-in), we arecommitted to advancing policies that will improveaccess and affordability – aligning health caredelivery around the consumer. We believe the bestpath forward is to strengthen what works inAmerica’s health care system – building on theAffordable Care Act and the employer-basedhealth care system.Cigna spent 7.22 million on federal lobbyingexpenses and approximately 4.16 million on statelobbying expenses. Cigna complies with therequirements of the Lobbying Disclosure Act of1995 (LDA) that govern disclosure of federallobbying expenses. Cigna also complies with therequirements of state laws relevant to statelobbying expenses and disclosure reporting.
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTTRADE ASSOCIATIONMEMBERSHIPSWhile Cigna recognizes that many of the trade associations in which it participates have broadmemberships with sometimes differing views, the Company believes that such organizations canencourage dialogue on important policy issues, ultimately helping to advance industry solutions.Cigna also believes that to be effective and informed, it is important to constructively engagediffering perspectives. Active participation in industry-related trade associations is one of the waysin which Cigna engages in public policy and legislative issues.Because of the breadth and depth of trade association views on key health care issues, Cignabelieves memberships in these organizations are generally consistent with the Company’s interests,including those of its shareholders and customers.Certain dues paid to these organizations may be used to support lobbying activity. In 2020, Cignawas a member of the following industry trade associations with more than 50,000 in annual duesand a percentage attributable to lobbying activity.OrganizationAllocated to Nondeductible2020 Annual Dues* PortionLobbying ExpenseAmerica’s Health Insurance Plans 2,500,00043%Association of Behavioral Health & Wellness 136,90014%Association of California Life & Health InsuranceCompanies 80,0006%Connecticut Association of Health Plans 135,29361%Florida Association of Health Plans Inc. 140,00020%Healthcare Distribution Alliance 241,10030%Massachusetts Association of Health Plans 91,93036%National Association of Dental Plans 65,82150%New Jersey Association of Health Plans 118,00019%Pharmaceutical Care Management Association 3,962,00026%Texas Association of Health Plans 75,00030%The Business Roundtable 300,00025%The Insurance Federation of Pennsylvania Inc. 51,05120%U.S. Chamber of Commerce 355,00025%Virginia Association of Health Plans 79,61620%*Annual dues do not include supplemental dues or special assessments. Table of Contents13
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTCignaPAC ANNUAL REPORT Table of Contents14
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORT15ABOUT CignaPACCignaPAC is Cigna’s federal political actioncommittee, a separate, segregated fundestablished and operated by Cigna, that is fundedentirely by voluntary contributions from eligibleemployees and regulated by federal and/or stategovernments. Cigna has also established separatebut related state political action committees inMissouri (Cigna MO PAC) and New York (Cigna NYPAC), which are referenced collectively in thisreport as CignaPAC unless otherwise noted.CignaPAC financially supports the electioncampaigns of candidates who share our views onpolicy issues, represent areas of geographicimportance or meet other criteria deemedappropriate by the CignaPAC Board of Directors.It also engages in the process by supportingnational and state party committees, as well asother political action committees and organizations.CignaPAC is committed to transparency regardingits activities. Cigna obeys all laws in promoting itspositions to government authorities, and allcontributions made by CignaPAC comply with allapplicable campaign finance regulations.After Cigna’s merger with Express Scripts HoldingCompany in December 2018, CignaPAC andExpress Scripts Political Fund (Express ScriptsPAC) operated as separate but affiliated politicalaction committees until the termination of ExpressScripts PAC in February 2020. Express ScriptsPAC did not make any political disbursements in2020. Express Scripts Missouri PAC wasterminated in January 2020 and did not make anypolitical contributions.BOARDOVERSIGHTCignaPAC is governed by the CignaPAC Board ofDirectors, which oversees contributions made withCignaPAC funds. CignaPAC makes politicalcontributions pursuant to the approval process forthe CignaPAC contributions and in accordance withCignaPAC Articles of Organization. ProposedCignaPAC contributions are reviewed in advanceand approved by the CignaPAC Board of Directors. Table of Contents
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTCignaPACCONTRIBUTION STRATEGYIn alignment with Cigna’s mission and values,CignaPAC supports candidates who advancepublic policies that will help realize our vision of amore affordable, predictable and simple healthcare system for all Americans. CignaPAC considersa variety of criteria in funding decisions, such ascommittee assignments and leadership positions;geographic concentration of Cigna employees in adistrict or state; key business markets; candidates’views on specific or emerging business issue(s);and candidates’ viability. In addition, someconsiderations are so foundational that theytranscend all matters of public policy; accordingly,CignaPAC’s contribution strategy reflects Cigna’scommitment to value diversity and inclusion, aswell as equity and equality, and CignaPAC willdiscontinue support of any elected official whoencourages or supports violence. These criteriaguide our decision-making to ensure we remainsteadfast to our values and drive forward ourvision of affordable, predictable and simple healthcare solutions for those we serve. CignaPAC doesnot participate in presidential primary or generalelection contests.Set forth on the following pages are the politicalcontributions made in 2020 by CignaPAC, CignaMO PAC and Cigna NY PAC. Table of Contents16
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTFEDERAL LEVELCONTRIBUTIONSU.S. House p.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep. Table of ContentsFirst AmerishSaludTonyJudyJ. EricMichaelJosephJahanaJamesJohnLisaLast alwellThompsonCourtneyHayesHimesLarsonBlunt RochesterPartyDRDRDRDDDDDDDDDRDDRDDDDDDDDDDDAmount 4,000 2,500 5,000 1,500 9,000 3,500 5,000 5,000 2,500 1,500 2,500 5,000 2,500 1,000 2,500 1,000 2,500 5,000 4,000 2,500 5,000 2,500 5,000 2,500 7,500 5,000 1,000 5,000 1,500 4,00017
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY .Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep. Table of ContentsFirst ichardAnthonyStenyLast nt 6,500 5,000 1,500 2,500 3,500 7,500 3,500 3,500 1,000 2,500 2,500 2,500 2,500 2,500 3,500 3,500 5,000 5,000 5,000 2,500 2,500 2,500 3,500 2,500 6,500 5,000 2,500 4,500 2,500 8,000 2,500 2,500 5,000 1,000 2,500 6,500 1,500 4,00018
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep.Rep. Table of ContentsFirst WilliamJamesThomasMarkwayneLast rtyDDDDRRDRDRDDRRRRRRRDDDDDDRDRRDDDRDRRRRAmount 1,500 2,500 2,500 2,500 5,000 2,500 7,500 10,000 5,000 1,000 2,500 2,000 5,000 2,500 4,000 2,500 5,000 5,000 1,000 5,000 5,000 2,500 2,500 2,500 5,000 2,000 5,000 3,500 2,500 2,500 4,000 3,000 2,500 2,500 5,000 2,000 1,500 5,00019
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY Rep.Rep.Rep.Rep.Rep.First G. lDanielVeronicaPatElizabethRonnyMichaelVan CampenMarcBenDonaldGeraldA. p.AdamMarilynRonaldGwendolynne Table of ContentsLast RRDRRDRRRRDRDRRRDDDDDRDDRAmount 4,000 2,500 2,500 4,000 1,500 2,000 2,500 2,500 4,000 5,000 2,500 2,500 2,500 3,500 2,500 2,500 4,000 5,000 2,500 2,500 1,000 5,000 2,500 2,500 2,500 4,000 5,000 2,500 2,500 3,500 2,500 4,000 1,500 5,000DDDD 5,000 5,000 5,000 2,50020
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTStateWIWYTitleRep.Rep.First NameBryanElizabethLast NameSteilCheneyPartyRRAmount 2,500 2,500In addition, CignaPAC contributed to the following U.S. House candidates’ leadership political ep.Rep.Rep.Rep.Rep.Rep. Table of ContentsFirst lliamAnnFrankWilliamDavidKevinWilliamSuzanLast elBenePartyDDRDDDRRRRDRRRRDAmount 5,000 2,500 5,000 5,000 5,000 1,500 5,000 2,500 1,000 5,000 5,000 2,500 5,000 5,000 5,000 5,00021
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTU.S. Senate n.Sen.Sen.Sen.Sen. Table of ContentsFirst Last nt 4,000 5,000 2,500 2,500 7,500 2,500 2,500 7,500 2,500 2,500 2,500 1,500 2,500 6,500 5,000 2,500 3,000 1,000 2,500 1,500 5,000 2,500 2,500 2,500 1,000 5,000 7,500 1,000 1,500 2,000 2,500 1,000 2,50022
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTIn addition, CignaPAC contributed to the following U.S. Senate candidates’ leadership political .Sen.Sen. Table of ContentsFirst CharlesRobTimothyMarshaJohnMichaelLast Cortez DRDRRRRDRRDDDDRRRRRAmount 5,000 2,500 5,000 5,000 5,000 2,500 2,500 5,000 5,000 2,500 5,000 5,000 5,000 2,500 5,000 2,500 5,000 2,500 5,000 5,000 2,500 5,00023
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTNational Party CommitteesPartyAmountDemocratic Congressional Campaign Committee (DCCC)D 15,000Democratic Senatorial Campaign Committee (DSCC)D 15,000National Republican Congressional Committee (NRCC)R 15,000National Republican Senatorial Committee (NRSC)R 15,000Other Political Action CommitteesOrganizationAcross the Aisle PACPartyDAmount 5,000America’s Health Insurance Plans, Inc. PACNP 5,000Blue Dog PACD 5,000CHC BOLD PACD 5,000Congressional Black Caucus PACD 5,000Elect Democratic WomenD 5,000Future Forum PACD 5,000Great America CommitteeR 5,000Moderate Democrats PACD 5,000New Democrat Coalition Action FundD 5,000PAC UnitatisR 5,000Pharmaceutical Care Management Association PACNP 5,000Republican Governance Group/Tuesday Group PACR 5,000Republican Main Street Partnership PACR 5,000Value in Electing Women PACR 5,000VoteVetsD 5,000NP – No party affiliation. Table of Contents24
2020 POLITICAL CONTRIBUTIONS AND LOBBYING ACTIVITY REPORTSTATE AND MUNICIPAL LEVELCONTRIBUTIONSState ep.Rep.Rep.Sen.Rep.Atty. en.Rep.Rep.Sen.Rep.Sen.Rep.Rep.Rep.Rep.Rep.Sen. Table of ContentsFirst ndonJeffreySylviaRussellSeanKateHeatherCesarLupeJ. JeniMarkShannonJeffLast yRutledgeUnderwoodWardlawAllenBowersBowieBrophy unt 500 500 1,000 1,000 500 500 1,000 500 2,000 500 500 2,000 1,000 1,000
KS Rep. Tom Sawyer D 200 KS Atty. Gen. Derek Schmidt R 1,500 KS Sen. Mark Steffen R 200 KS Sen. Gene Suellentrop R 250 KS Rep. William Sutton R 200 KS Sen. Mary Ware D 200 KS Sen. Richard Wilborn R 250 LA Rep. Lawrence Bagley R 1,000 LA Sen. Louie Bernard R 1,250 LA Sen. Gerald Bo
San Diego Municipal Code Chapter 2: Government (8-2019) Article 7: Elections, Campaign Finance and Lobbying Division 40: Municipal Lobbying (“Municipal Lobbying” added 5–18–1998 by O–18511 N.S.) §27.4001 Purpose and Intent It is the purpose and intent of the City Council of the City of San Diego in enacting
Lobbying: Sweet Smell of Success? A case study on the transparency of lobbying around sugar regulation in the European Union and Spain. 1 The case of Jack Straw The case of the ex-Minister of Home Affairs for the UK, adds weight to such allegations of aggressive lobbying; who
DOCUMENT RESUME. ED 076 468. SO 005 648 TITLE Why Lobby? A General Curriculum Guide to Lobbying. The Lobbyist: A General Guide on Lobbying. The. Lobbying Game. INSTITUTION Multi-District Inst. for Political Education, Pitman, N. J. PUB DATE [72] NOTE. 67p. EDRS PRICE MF- 0.65 HC- 3.29 DESC
2 Training Manual on Advocacy, Lobbying and Negotiation Skills for Indigenous Peoples in Climate Change and REDD In this module, we will be introducing our indigenous participants the concept of advocacy and lobbying. We will frame the discussion so that our advocacy and lobbying is directly related to the assertion and
Quantifying Prosecutor Lobbying . Overall, prosecutors were involved with % of bills 2that were introduced. 27 The extent of prosecutor lobbying varied from state to state. Prosecutors in Nebraska and Ohiolobbied on more than 95% of bills, while prosecutors in Maryland and Pennsylvania % bills introduced and lobbied on only 7
Lobbying is taking that same courage and stepping one more step forward to pass laws and influence policy to make progress towards your goals. In the Introduction and Groundwork Guide, we outline a few pathways your nonprofit may take. If you decide that "Step-It-Up Advocacy" is the right pathway for you, you engage in lobbying. A few things to
The Clerk’s Lobbying Bureau Annual Report dated March 1, 2012 contains additional penalties and fines, audits, other enforcement an d outreach efforts, some of which may have occurred after the testimony and submissions by the Clerk to the Commission. 3 See, e.g., Clerk’s Lobbying Bureau
can contemplate whether reforms are needed and if a more precise voluntary corporate lobbying disclosure code makes sense. Findings Corporate Policies Just one-quarter of the S&P 500 have board-level policies regarding lobbying. However, this is an increase from only 16 percent in 2013. (Chart, p. 9, shows corporate governance trends.)
