MCAS Biology Review Answer Key - WordPress
NameDateMCAS Biology Review Answer KeyI. The Chemistry of LifeBroad Concept: Chemical elements form organic molecules that interact to perform the basic functions oflife.1. What are the six most common elements in living things?CHNOPS (carbon, hydrogen, nitrogen, oxygen, phosphorus, sulfur)2. One of the six elements above is the building block for living things because of its ability to formcovalent bonds with a variety of elements. Which element is this?carbon3. Organic molecules form the structures of all living organisms. Fill out the table below:BuildingOrganic MoleculeElementsFunctionsExamplesBlocks/SubunitsC, H, OSugars (oftenGlucose, cellulose,CarbohydrateShort-term energy storageend in –ose)starchWaxes, oils,C, H, OFatty acids andLong-term energyLipidsteroids,triglyceridestorage, cell membranephospholipidsC, H, O, N,Enzymes, transport,helicase,Proteinsometimes SAmino acidscommunication, structurehemoglobinand PC, H, O, N, PStore and transmitNucleic AcidNucleotidesDNA, RNAgenetic information4. What are enzymes, and how do they work? Why are enzymes important?Enzymes are large, complex proteins that speed up chemical reactions by lowering the activationenergy. Without enzymes, reactions inside our bodies would take much too long!5. How does temperature affect enzyme function? How does pH affect enzyme function?Enzymes work faster as the temperature increases, up to a certain point. (If you boil an enzyme,the structure changes – the enzyme is denatured – and it no longer works.) Each enzyme works ina particular pH range.II. Cell BiologyBroad Concept: Cells have specific structures and functions that make them distinctive. Processes in acell can be classified broadly as growth, maintenance, and reproduction.6. Draw and describe the structure of the plasma membrane.Phospholipid bilayer with embedded proteins the phospholipids havepolar/hydrophilic heads and nonpolar/hydrophobic tails. Some of theproteins extend through the membrane; others are found on the surfaceonly.7. Why is the plasma membrane important to cells?Controls what enters and exits the cell small, nonpolar molecules (such as oxygen) easily passthrough while larger molecules (such as glucose) need to travel through a protein.
8. What are three structures that all cells have?Plasma membrane, cytoplasm, and genetic material9. What are three major differences between prokaryotes and eukaryotes?Prokaryotes are smaller, do not contain a nucleus, and do not contain membrane-boundorganelles.10. Give three differences between cell walls and cell membranes.Cell membranes are found in all cells; cell walls are found in plants, fungi, some protists, andsome bacteria. Cell membranes are flexible and made of phospholipids; cell walls are rigid andmade of cellulose (plants) or chitin (fungi). Cell membranes control what gets in and out of a cell;cell walls provide support and structure.11. Provide three differences between mitochondria and chloroplasts.Mitochondria make ATP using glucose in cellular respiration; chloroplasts make glucose duringphotosynthesis. Mitochondria are found in all eukaryotes; chloroplasts are found in plants andsome protists only. Mitochondria use oxygen and release carbon dioxide; chloroplasts use carbondioxide and release oxygen.12. How does a lysosome differ from a vacuole?A lysosome contains digestive enzymes; a vacuole stores water and other substances.13. What does the endoplasmic reticulum do? The Golgi apparatus?The endoplasmic reticulum is responsible for transport within the cell (post office)The Golgi apparatus packages materials to be exported out of the cell (UPS)14. What is osmosis?Diffusion of water from areas of high water concentration (hypotonic) to areas of low waterconcentration (hypertonic). Water follows the solutes!15. Provide two differences between simple diffusion and active transport.Simple diffusion is passive, meaning the molecules move from high to low concentration withoutthe use of energy. Active transport requires energy and molecules move through a membraneprotein.16. Complete the chart below for each of the six kingdoms:Prokaryote orAutotrophs orUnicellular r(except ularMCAS Biology Review p. 2E. coliAlgae, paramecium,euglenaMushrooms, mold, yeastTrees, flowers, fernsWorms, spiders, sharks,humans
17. Give the equation for photosynthesis in words and chemical symbols. Why is photosynthesisimportant?CO2 H2O E C6H12O6 O2 / carbón dioxide wáter light energy glucose oxygenPhotosynthesis provides all of the chemical energy for an ecosystem. Also supplies oxygen.18. Give the equation for cellular respiration in words and chemical symbols. Why is cellularrespiration important?C6H12O6 O2 ATP CO2 H2O / glucose oxygen ATP carbón dioxide wáterCellular respiration allows all organisms to make ATP, which is energy that is necessary to powermany types of chemical reactions in cells19. Which kingdoms contain organisms that undergo cellular respiration? Which kingdoms containorganisms that undergo photosynthesis?All organisms undergo cellular respiration.Some bacteria, some protists, and all plants undergo photosynthesis20. What is ATP? Why is it important to living things?ATP adenosine triphosphateEnergy transfer molecule for living organisms; made during cellular respiration and then used inchemical reactions such as protein synthesis, mitosis, and active transport.21. Provide three differences between mitosis and meiosis.Mitosis goes through 1 division; meiosis involves 2 divisions. Mitosis produces 2 identical cells;meiosis produces 4 unique cells. Mitosis is used for growth and repair; meiosis is used forcreation of gametes (sex cells). Mitosis produces diploid cells; meiosis produces haploid cells.22. What is interphase?Stage of the cell cycle when the cell is metabolically active, is growing, and is preparing to divideby undergoing DNA replication.23. What is cytokinesis?Division on the cytoplasm; follows mitosis.24. How are gametes different from other cells?Gametes are haploid (contain half the number of chromosomes – one from each pair)25. What happens during fertilization? What is a zygote?Egg (female gamete) and sperm (male gamete) come together and the nuclei fuse, creating azygote. The gametes are haploid (ex – 23 chromosomes) and the resulting zygote is diploid (ex –46 chromosomes). The zygote can then undergo mitosis to grow into a multicellular organism.26. What is the structure of a typical virus?Genetic material surrounded by a protein coat. (NOT a cell!)27. How does a virus typically reproduce?A virus invades a host cell and then uses the host cells enzymes and ribosomes to create morecopies of the genetic material (DNA or RNA) and new protein coats. The new viruses are thenassembled within the host cell, and then the viruses break free from the host cell and infect newcells.MCAS Biology Review p. 3
III. GeneticsBroad Concept: Genes allow for the storage and transmission of genetic information. They are a set ofinstructions encoded in the nucleotide sequence of each organism. Genes code for the specific sequencesof amino acids that comprise the proteins that are characteristic of that organism.28. Describe the structure of DNA, including the structure of its subunits.DNA is a double helix made of repeating units of nucelotides. Each nucleotide consists of a sugar(deoxyribose), a phosphate, and a nitrogen base. The two strands of DNA are complementary.The backbone of the double helix is made of sugar-phosphate bonds. Nitrogen bases hold the twostrands of DNA together.29. What are the four DNA bases and their one-letter abbreviations?A adenine; T thymine; C cytosine; G guanine30. Why is DNA important to living things?Stores all genetic information, which means it codes for all proteins. Enables information to bepassed down from one generation to the next.31. How is DNA replicated? List the steps and identify one key enzyme.Double helix is unwound by helicase. Each strand acts as a template for building the new strand.DNA polymerase adds new nucleotides (A-T and C-G). This is known as semiconservativereplication.32. Give the complementary strand for this strand of DNA:ATTAGCGAGATCTAATCGCTCTAG33. How does DNA differ from RNA? Provide three differences.DNA is double-stranded; RNA is single-stranded. DNA has thymine (T); RNA has uracil (U).DNA has deoxyribose sugar; RNA has ribose sugar. DNA cannot leave the nucleus; RNA isfound throughout the cell.34. List the three types of RNA. What is the function of each?Messenger (mRNA) – brings DNA code from the nucleus to the ribosomeTransfer (tRNA) – carries amino acids to the ribosome to form polypeptide chainRibosomal (rRNA) – makes up the ribosome, along with proteins35. Protein synthesis describes the flow of genetic information from gene to protein, and includes twokey steps, transcription and translation. Fill in the chart below:ProcessStarting MaterialEnd ionmRNA and free aminoacids attached to tRNAAmino acid chain(polypeptide chain)Ribosome in cytoplasm36. Transcribe this DNA strand into mRNA:TGTCCATAGCTCACAGGUAUCGAG37. Use a genetic code chart or wheel to translate this mRNA strand into the amino acids:AUGGCGUUCACAMethionine – Alanine – Phenylalanine - ThreonineMCAS Biology Review p. 4
38. Do all genetic mutations cause phenotypic changes (changes in the proteins that are made)? Whyor why not?NO – some genetic mutations are silent, which means that although the DNA is changed, theamino acid is not changed so the protein stays the same39. Are all genetic mutations bad? Explain why or why not?No, some mutations may be beneficial, such as improving eyesight, etc.40. Assume T tall plants and t short plants. Which of these alleles is dominant and which isrecessive? What does this mean?T (tall) is dominant (capital letter) whereas t (short) is recessive. The dominant trait (tall) willmask the recessive trait (short) in a heterozygous individual.41. What is the difference between a plant that is homozygous tall and a plant that is heterozygoustall?Homozygous tall TT (2 dominant); Heterozygous tall Tt (1 dominant, 1 recessive)42. Use a Punnett square to show the expected results of a cross between two heterozygous tallplants.Tt x TtTtTTT TttTttt43. Explain Mendel’s law of segregation.The alleles for a gene separate during meiosis because the chromosome pairs separate duringmeiosis.44. Explain Mendel’s law of independent assortment.The alleles for one gene separate independently from alleles for another trait on a differentchromosome pair. This increases genetic diversity because each gamete can receive manydifferent combinations of alleles (chromosomes).45. How many unique gamete possibilities exist from a parent with the genotype AaBb? Identifyeach.4 unique gametes: AB, Ab, aB, ab (each gamete would receive one allele for each gene)46. What is incomplete dominance? Give an example.Neither allele is dominant; the results are blended. Ex - red flower x white flower pink flower47. What is codominance? Give an example.Both alleles are dominant; both traits can be seen. Ex - black cat x white cat spotted cat48. What are polygenic traits? Give an example.Traits controlled by many genes. Ex - hair color, eye color, skin color.49. What are sex-linked traits? Give an example.Gene is found on the X chromosome. (Females are XX; males are XY.) These traits are morecommon among males. Ex – red-green colorblindness, hemophilia50. Why are human blood types considered “multiple allele” traits?There are 3 different alleles: I A, IB, and i (or A, B, and O)MCAS Biology Review p. 5
IV. AnatomyBroad Concept: There is a relationship between the organization of cells into tissues, and tissues intoorgans. The structure and function of organs determine their relationships within body systems or anorganism. Homeostasis allows the body to perform its normal functions.51. Explain how the digestive system (mouth, pharynx, esophagus, stomach, small intestine, largeintestine, and rectum, with the aid of the liver, gall bladder, and pancreas) would convertmacromolecules from a ham and cheese sandwich into smaller molecules that can be used bycells for energy and for repair and growth.Mechanical digestion begins in the mouth; the pharynx produces salivary amylase that startschemical digestion. Food travels through the esophagus to the stomach, where the acidic pH andpepsin continue digestion. Food then enters the small intestine, where digestion is completed withthe help of the liver (bile – stored in the gall bladder) and pancreas (pancreatic enzymes).Nutrients are absorbed in the small intestine, and then food passes into the large intestine wherewater can be absorbed. Solid waste is stored in the rectum until it can be eliminated.52. Explain how the circulatory system (heart, arteries, veins, capillaries, red blood cells) transportsnutrients and oxygen to cells and removes cell wastes.The heart is a muscular pump that is responsible for moving blood throughout the arteries (awayfrom the heart), into capillaries, and then back to the heart through the veins. The capillaries areonly one-cell thick, so oxygen and nutrients and diffuse into body cells and carbon dioxide andwastes can diffuse back into the blood cells. Red blood cells contain hemoglobin, which bindsoxygen.53. How are the kidneys closely related to the circulatory system?The kidneys filter waste from the blood and create urine, which is stored in the bladder. Thekidneys also help to regulate the water level of blood.54. What role does the liver play in digestion? What role does the liver play with the circulatorysystem?The liver produces bile, which helps to break down and absorb fats. The liver also filters outtoxins from the blood.55. Explain how the respiratory system (nose, pharynx, larynx, trachea, lungs, alveoli) providesexchange of oxygen and carbon dioxide.Air enters the body through the nose and pharynx, passes the larynx where sound can beproduced, into the trachea and bronchi, and then enters the lungs. The alveoli are small air sacswithin the lungs where gas exchange occurs. Oxygen diffuses from the alveolil into thecapillaries, and carbon dioxide diffuses from the capillaries into the alveoli. The diaphragm is themuscle that allows breathing to happen.56. What is the difference between the central nervous system and the peripheral nervous system?The central nervous system consists of the brain and spinal cord; the peripheral nervous systemcontains all of the nerves that connect the CNS with the rest of the body.57. Draw a neuron, label the parts (dendrites, cell body, axon, axon terminal) and explain generallyhow it transmits messages.The dendrite receives a chemical signal (neurotransmitters) and sendsan electrical signal down the axon, which causes the axon terminal torelease more neurotransmitters, hence electrochemical signaling!MCAS Biology Review p. 6
58. Explain the differences between the skeletal, smooth, and cardiac muscle.Skeletal muscle is voluntarily controlled; smooth and cardiac muscle are involuntarily controlledby the autonomic nervous system. Both skeletal and cardiac muscle are striated (striped).59. Explain how the muscular/skeletal system (skeletal muscle, bones, cartilage, ligaments, tendons)works with other systems to support and allow for movement.The skeletal muscle uses the bones as levers to allow for movement. Bone also provide supportand protection. Cartilage acts as a cushion and site for new bone growth. Ligaments connect twobones together. Tendons connect bone to muscle.60. Where are red and white blood cells produced?In the bone marrow (spongy part of long bones)61. How does the sexual reproductive system allow organisms to produce offspring that resemble, butare not identical to, either of their parents?Gametes are formed by meiosis in the gonads (testes or ovaries). Gametes only contain half thenumber of chromosomes, so when a zygote is formed during fertilization, half of thechromosomes come from the father and half from the mother.62. The human body has two major communication systems. Explain how the body uses bothelectrochemical signals and chemical signals (hormones) to communicate messages from one partof the body to cell to cells in another part of the body?Electrochemical signals occur in the nervous system between two neurons or a neuron and muscleor gland. Hormones are produced by endocrine glands and travel long distances through the bloodstream to send a message. Hormones can affect many target cells at once.63. The body’s systems interact to maintain homeostasis. Describe the basic function of aphysiological feedback loop using the following example: The brain monitors the concentrationof solutes in the blood and sends signals to key organs to maintain water balance.If the brain detects that there is too much water in the blood, a message will be sent to the kidneysto absorb more water from the blood. Once the acceptable water level is reached, the brainreceives that information and then cancels the message to the kidneys to absorb more water.V. Evolution and BiodiversityBroad Concept: Evolution is the results of genetic changes that occur in constantly changingenvironments. Over many generations, changes in the genetic make-up of populations may affectbiodiversity through speciation and extinction.64. What is meant by the term “evolution”?Genetic changes in a population over a long period of time65. Identify and describe the four principles of Darwin’s theory of natural selection using thefollowing example: Millions of years ago, the ancestors of giraffes had shorter necks. Today,giraffes have longer necks that allow them to eat leaves that other animals cannot reach.Variation: some giraffes had shorter necks, and others had longer necksHeritability: the gene for neck length is passed from one generation to the nextOverpopulation: the giraffes with shorter necks had to compete with other animals for food andwere less likely to survive and reproduceReproductive Advantage: the giraffes with longer necks were able to get enough food moreeasily, and they were able to survive and reproduce, passing on the gene for long necksMCAS Biology Review p. 7
66. Explain why the fossil record is useful in supporting evolution.Allows scientists to compare species that once lived with species that are now alive. Also allowsscientists to compare organisms as they changed over time.67. Explain how comparing skeletons and body parts can help explain evolution.Homologous structures, such as the limb bones of vertebrates, show that species came from acommon ancestor. (Human arm, bat wing, and whale fin all have very similar bone structuredespite their different functions.)68. Explain how recent advances in genetics and molecular biology support evolution, even thoughDarwin didn’t have access to this information.By comparing DNA and amino acid sequences, scientists can see how closely related two speciesare (more similarities closer relationship). Darwin made these observations based on physicalevidence; the genetic evidence supports everything else.69. What are homologous structures? Give three examples.Homologous structures show similarities due to common ancestry. Ex – limb bones, number ofneck vertebrae, mollusk “feet”70. What is a vestigial organ? Give two examples in humans and one in another animal.Vestigial organs do not have a current known function but show history because an ancestor hadthis organ and it functioned. Ex – appendix, tailbone, femur in whale71. Define “species.”A group of organisms of the same type that can successfully reproduce wit
MCAS Biology Review Answer Key I. The Chemistry of Life Broad Concept: Chemical elements form organic molecules that interact to perform the basic functions of life. 1. What are the six most common elements in living things? CHNOPS (carbon, hydrogen, nitrogen, oxygen, phosphorus, sulfur) 2.
2016 MCAS Results September 29, 2016 Page 4 8 Year Math CPI Results For State, District, and Schools Ranked by 2016 CPI School el 2009 Math MCAS 2010 Math MCAS 2011 Math MCAS 2012 Math MCAS 2013 Math MCAS 2014 Math MCAS 2015 Math MCAS 2016 Math PARCC Sewell-Anderson 1 80.0 78.7 76.7 84.2 88.3 89.0 89.3 92.5
animation, biology articles, biology ask your doubts, biology at a glance, biology basics, biology books, biology books for pmt, biology botany, biology branches, biology by campbell, biology class 11th, biology coaching, biology coaching in delhi, biology concepts, biology diagrams, biology
Beginning MCAs (open at start of FY 2016-17) 531 Ending MCAs (open at end of FY 2016-17) 568 Past Due MCAs High-risk past due MCAs 33 Medium/low risk past due MCAs as of June 30, 2017 151 . . Overall results are summarized systemwide with key themes identified. Corrective action and associated
public release of statewide MCAS results for all 10th-graders and for students in grades 3 through 8 who took MCAS. In Springfield, 27 schools took the MCAS test and 31 took PARCC (with four schools taking parts of both). From 2012 to 2015, SPS students’ MCAS Composite Performance Index (CPI), which measures academic
Reporting Period: January 1, 2016 through December 31, 2016 Filing Deadline: April 30, 2017 Contact Information MCAS Administrator The person responsible for assigning who may view and input company data. MCAS Contact The person most knowledgeable about the submitted MCAS data. This person can be the same as the MCAS Administrator. MCAS Attestor
2020 MCAS Biology test, including the reporting category and standards associated with each item. Beginning in 2019, the Department no longer releases items from the February Biology test. The decision to withhold the items from the February Biology test assists the Department in producing hig
All references to page numbers in answer booklets have been deleted from the directions that accompany test items. II. February 2016 Biology Test. 4 February 2016 Biology Test The February 2016 high school MCAS Biology test was based on learning standards in the Biology content strand of the Massachusetts Science and Technology/Engineering .
Chapter II of this document contains information for the February 2017 Biology test and has three main sections. The first section introduces the chapter by listing the Massachusetts curriculum framework content strands assessed by the Biology MCAS test. These content strands are identical to the MCAS reporting categories under which test
