Sucrose Synthase Expressions In Sugarcane And Their .

Available online at www.pelagiaresearchlibrary.comPelagia Research LibraryAsian Journal of Plant Science and Research, 2017, 7(6):28-40ISSN : 2249-7412CODEN (USA): AJPSKYSucrose Synthase Expressions in Sugarcane and Their Relations with SucroseAccumulationLuguang Wu1*, Terry Morgan2, Yunrong Pan1 and Hao Long1School of Agriculture and Food Science, University of Queensland, Queensland 4072, Australia2CSR Ltd, Ayr, Queensland 4807, Australia1ABSTRACTExpression sequence tags and tentative consensus sequences of sucrose synthase (SUS) genes in sugarcane databasewere blasted based on well-characterized SUS genes from other fully genome sequenced plant species. SUS expressionprofiles from RT-qPCR on an elite cultivar Q117 grown in glasshouse showed distinctive but overlapped patterns ofSUS members over different tissues and developmental stages. Further characterization on field grown high- vs. lowsugar lines demonstrated relatively tight correlations between sucrose contents in whole cane juice and transcriptlevels of two SUS members at different developmental stages, as well as their enzyme activities in sucrose cleavagedirection. Prospects of the experiment results on enhancement of sucrose accumulation in sugarcane molecularbreeding by manipulating SUS genes were discussed.Keywords: Saccharum sp., Sucrose synthase expression, Sucrose accumulationAbbreviations: SUS: Sucrose Synthase; CCS: Commercial Cane Sugar; TVD: Top Visual DewlapINTRODUCTIONSucrose accumulation is particularly interest in sugarcane (Saccharum sp.) as it produces about 75% of world sucrose.It is a dynamic process of a continuous cleavage and synthesis in sugar storage parenchyma tissue [1,2]. About 22%of stored sucrose is cleaved and re-synthesized [3] in a process called a ‘futile cycling’. Futile cycling is energywasteful since ATP is required for sucrose resynthesis, which might be an important plant response to some specificenvironmental stresses. However, under favourable agronomic conditions, it could be minimized to enhance sucroseaccumulation.Sucrose synthase (E2.4.1.13) transfers the glucose moiety from sucrose to form uridine 5’-diphosphate glucose(UDPG) and leaves the fructose part behind. Though sucrose synthase catalyses a reversible reaction, it is widelybelieved that the digestion direction is the main reaction in mature sugarcane stem tissues [4,5]. In sucrose isomerisetransformed sugarcane suspension cell lines, sucrose synthase activity showed the most consistent and strongestdown-regulation among all sucrose hydrolysing enzymes, along with highly accumulated sucrose content [6]. Downregulation of a sucrose synthase gene may enhance sucrose accumulation. The technique of down-regulating a specificgene is applicable in sugarcane [7,8].Sucrose synthase is encoded by multiple genes in plant species, playing individual roles but having expression patternsoverlapped [9,10]. In polyploidy sugarcane, several sucrose synthase genes have been cloned with full lengths [11-14]three forms sucrose synthase proteins have been partially purified from sugarcane tissues [15] and five genes havebeen identified based on the comparison with other fully genome-sequenced plant species such as sorghum [16].Pelagia Research Library28

Wu et alAsian J. Plant Sci. Res., 2017, 7(6):28-40However, the sucrose synthase expression patterns and their correlations with sucrose accumulation have not beenreported yet in sugarcane.In this study, we further classified the expressed sugarcane sucrose synthase genes available in sugarcane databaseand demonstrated their expression patterns in sugarcane. We revealed associations between expression levels ofspecific member(s) of sucrose synthases and sucrose contents in high- vs. low-sucrose lines derived from conventionalbreeding.MATERIALS AND METHODSPlant materialsSugarcane from glasshouseSugarcane cultivar Q117 plants were grown in a containment glasshouse under natural light intensity at 28 2 C withwatering twice a day. Each plant was grown as a single stalk in a pot of 20 cm diameter (4 L volume) and sampled asa 9-month old ratoon. Leaves were numbered as one for the top visual dewlap (TVD), with higher numbers for olderleaves. Internodes were numbered according to the leaf attached to the node immediately above. The sampled tissuesinclude non-photosynthetic (spindle)-3 and (spindle)-2 leaves, mature leaf blades ( 3) and sections from the middleof internodes 3, 7 and 15. These internodes represent different physiological status of stalk that were elongatinginternodes, sucrose loading and matured, respectively. The roots were sampled by carefully selecting the white tenderones. Stem samples were rapidly cored by a hole-borer. All samples were immediately frozen in liquid nitrogen,then transported in liquid nitrogen to the laboratory and temporarily stored in -80 C for late analyses of sugars, orextractions of RNA and enzymes.Sugarcane from conventional breedingEight lines with similar growth and stalk biomass from two bi-parental crosses (KQ97 from Q117 x MQ77-340,n 237; KQ04 from ROC1 Q142, n 300) were selected for the experiment. Four lines with high commercial canesugar (CCS) (KQ97-5080, KQ04-6493, KQ97-6677, KQ04-6498) and four with low CCS (KQ04-6461, KQ04-6641,KQ97-6765, KQ97-2599) were planted in a field trial with three replicates (10 m row a replicate), at Kalamia, NorthQueensland (19 32′S, 147 24′E). Normal commercial agronomic practices were applied. Samples were taken onthe first ratoon crop, when the plants were 9 months old with around 22 internodes. In all samplings, materials werepooled from three plants per replicate. The numbering on internodes was the same as glasshouse sampling. Stemsamples were rapidly cored by a hole-borer and frozen in liquid nitrogen in the field, then transported on dry ice to thelaboratory for analyses of sugars, enzymes and RNA. The remainder of the culm from the sampled stalks was crushedusing a small mill for juice extraction. Brix was measured on a 300 µl sample of this ‘whole-stalk’ juice using a pocketrefractometer (PAL-1, Atago Co. Ltd, Japan) zeroed using Milli Q water prior to each sample.RNA extraction and cDNA synthesisFrozen plant tissues were ground into fine powder with liquid nitrogen by ball milling (Retsch MM301, Germany).Total RNA was extracted using Trizol following the kit protocol (Invitrogen). Each tissue was extracted with 3replicates. RNA concentration was determined using a Nanodrop ND-1000 (Biolab).Complementary DNA was prepared from 1 µg total RNA, following the protocol described in the Superscript III firststrand synthesis kit (Invitrogen).Primer design and RT-qPCRPrimers of the sucrose synthase genes for sugarcane were designed as subfamily-specific but universal within eachsubfamily. Mismatched base pairs for each subfamily were generally designed to be located at the 5’ end of the primerand the total was minimized to less than 3% of the total base pairs involved (Table 1). Primer designing principlesfrom the software package Primer Express (Applied Biosystems) were also considered for the five sucrose synthasegene members in sugarcane.Pelagia Research Library29

Wu et alAsian J. Plant Sci. Res., 2017, 7(6):28-40Table 1: Sugarcane SUS member specific primers used for RT-qPCROligo NamePrimer SequenceESTs1bps2Mismatch3 (%)ScSUS1 FTGGTCCGGCTGAGATCATC356651.8ScSUS1 RTCCAGTGGCTCGAATCTGTCTG306601.4ScSUS2 FGTGCGGTTTGCCAACAATT408003.0ScSUS2 RAAATATCTGCAGCCTTGTCACTGT4010001.9ScSUS4 FCATAACAGGACTGGTTGAAGCTTT82000.5ScSUS4 RCCTTGGACTTCTTGACATCATTGTA92340.4ScSUS5 FCACATATTCATTCCATTGAGACC61380.0ScSUS5 RTGTAACCATGTACACTTTCAGTC61380.0ScSUS6 FATGTACTGGAACAGAATGTCC51050.0ScSUS6 RTGAAGGTTGTAGAACATTTGT51051.8GAPDH FCACGGCCACTGGAAGCAGAPDH RTCCTCAGGGTTCCTGATGCCAvailable ESTS on the web sides in each subfamilybps: total base pairs involved; bps primer length available ESTs;Mismatch (%) mismatched base pairs/(primer length in base pairs EST number)RT-qPCR was run on an ABI PRISM 7900HT Sequence Detection System after preparation on an EppendorfepMotion 5075 Workstation. Each 10 μL reaction contained 1x SYBR Green PCR Master Mix (Applied Biosystems),200 nM primers and 1:25 dilution of cDNA (from 40 μL cDNA synthesis). The RT-qPCR program was run at 95 C for10 min, 45 cycles of 95 C for 15 s and 59 C for 1 min, then dissociation analysis at 95 C for 2 min and 60 C for 15 sramping to 95 C for 15 s. Means from three sub-samples were used for each analysed cDNA sample.Amplicons were cloned into pCR 2.1-TOPO vector (Invitrogen) and multiple products were sequenced to confirmsucrose synthase member specificity.The reference gene for quantitative PCR was the cytosolic isoform of glyceraldehydes-3-phosphate dehydrogenase(GAPDH) that exhibited stable levels of expression in a broad range of sugarcane tissues [17].Crude enzyme extractionEnzymes were extracted by grinding the frozen powder (as for RNA extraction) in a chilled mortar using 3 volumesof extraction buffer that contained 0.1 M Hepes-KOH buffer, pH 7.5, 10 mM MgCl2, 2 mM EDTA, 2 mM EGTA,10% glycerol, 5 mM DTT, 2% PVP and 1x complete protease inhibitor (Roche) as detailed [18]. The homogenatewas centrifuged at 10,000x g for 15 min at 4 C. The supernatant was immediately desalted on a PD-10 column (GEHealthcare) that was pre-equilibrated and eluted using an extraction buffer without glycerol. This desalted extract wasused for enzyme assays. Protein concentration was assayed by the Bradford reaction using a Bio-Rad kit with bovineserum albumin standards.Sucrose synthase assaysSucrose synthase activity (breakage) was assayed in a reaction mixture comprising 100 mM Tris-HCl buffer pH 7.0, 2mM MgCl2, 160 mM sucrose and 2 mM UDP. Blank reactions without UDP were included as an additional negativecontrol. After 30 min at 30 C, the assay was terminated by boiling for 10 min. The fructose product was measuredusing a BioLC as described below and further confirmed according to UDPG levels as described [18].Sugar determinationTo measure intracellular glucose, fructose and sucrose, the frozen powder was diluted in 1:20 water (w:w) and thenheated for 10 min at 96 C to inactivate enzymes, centrifuged at 16,795x g for 10 min at 4 C to remove particulatesand analysed by HPAEC [19].BLAST searchesAll sucrose synthase ESTs were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov) and all tentativeconsensus (TC) sequences were from the Computational Biology and Functional Genomics Laboratory . Sorghum and rice genomes were blasted on the Phytozome database (http://www.phytozome.net/search.php).Pelagia Research Library30