CHI3L1 Results In Poor Outcome Of Ovarian Cancer By .

2y ago
7 Views
3 Downloads
3.26 MB
16 Pages
Last View : 21d ago
Last Download : 2m ago
Upload by : Luis Wallis
Transcription

Endocrine-RelatedCancerH-W Lin et al.26:1CHI3L1 induces cancer stemlike cell properties73–88RESEARCHCHI3L1 results in poor outcome of ovarian cancerby promoting properties of stem-like cellsHan-Wei Lin1, Ying-Cheng Chiang2, Nai-Yun Sun1, Yu-Li Chen2, Chi-Fang Chang2, Yi-Jou Tai2, Chi-An Chen2 andWen-Fang Cheng1,2,31GraduateInstitute of Oncology, National Taiwan University, Taipei, Taiwanof Obstetrics and Gynecology, National Taiwan University, Taipei, Taiwan3Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan2DepartmentCorrespondence should be addressed to W-F Cheng: wenfangcheng@yahoo.comAbstractThe role of chitinase-3-like protein 1 (CHI3L1) in ovarian cancer and the possiblemechanisms were elucidated. CHI3L1 is a secreted glycoprotein and associated withinflammation, fibrosis, asthma, extracellular tissue remodeling and solid tumors. Ourprevious study showed CHI3L1 could be a potential prognostic biomarker for epithelialovarian cancer and could protect cancer cells from apoptosis. Therefore, clinical dataand quantitation of CHI3L1 of ovarian cancer patients, tumor spheroid formation, sidepopulation assays, Aldefluor and apoptotic assays, ELISA, RT-PCR, immunoblotting andanimal experiments were performed in two ovarian cancer cells lines, OVCAR3 andCA5171, and their CHI3L1-overexpressing and -knockdown transfectants. High expressionof CHI3L1 was associated with poor outcome and chemoresistance in ovarian cancerpatients. The mRNA expression of CHI3L1 in CA5171 ovarian cancer stem-like cells was3-fold higher than in CA5171 parental cells. CHI3L1 promoted the properties of ovariancancer stem-like cells including generating more and larger tumor spheroids and a higherpercentage of ALDH in tumor cells and promoting resistance to cytotoxic drug-inducedapoptosis. CHI3L1 could induce both the Akt (essential) and Erk signaling pathways,and then enhance expression of β-catenin followed by SOX2, and finally promote tumorspheroid formation and other properties of ovarian cancer stem-like cells. OVCAR3CHI3L1-overexpressing transfectants were more tumorigenic in vivo, whereas CA5171CHI3L1-knockdown transfectants were not tumorigenic in vivo. CHI3L1 critically enhancesthe properties of ovarian cancer stem-like cells. CHI3L1 or CHI3L1-regulated signalingpathways and molecules could be potential therapeutic targets in ovarian cancer.Key Wordsff ovarian cancerff cancer stem-like cellsff chitinase-3-like protein 1ff SOX2ff β-catenin (CTNNB1)Endocrine-Related Cancer(2019) 26, 73–88IntroductionOvarian carcinoma is the leading cause of death amongall gynecologic malignancies, with more than 70% ofwomen presenting with advanced-stage disease (Cohenet al. 2014). The annual incidence rate of ovarian cancerin the United States was 12.2 per 100,000 and the deathrate was 8.2 per 100,000 in 2007 (U.S. Cancer i.org/10.1530/ERC-18-0300 2019 Society for EndocrinologyPublished by Bioscientifica Ltd.Printed in Great BritainWorking Group); these rates were respectively 9.12 and3.09 in Taiwan (Chiang et al. 2013). The poor prognosisfor these patients is the result of a lack of symptoms,difficulties in early diagnosis, insufficient accurate tumormarkers and deficiency of knowledge about ovariantumor cell biology (Pinke et al. 2008). The standardDownloaded from Bioscientifica.com at 01/17/2022 03:49:54AMvia free access

Endocrine-RelatedCancerH-W Lin et al.treatment for ovarian cancer is surgical tumor debulking,followed by platinum-containing chemotherapy (Agarwal& Kaye 2003, Nagourney et al. 2003). Conventionalprognostic parameters for ovarian carcinoma are tumorstage, residual tumor volume after surgery, histologictype, differentiation grade and response to chemotherapy(van der Burg et al. 1988). However, these factors do notpresent a comprehensive picture of the tumor biologyof ovarian cancer and are frequently interrelated. Thus,identifying the molecular pathways of ovarian canceris extremely important for diagnosis and treatment ofthis disease.Increasing evidence supports the hypothesis that asubpopulation of cancer cells with stem cell features lurkswithin cancers (Crea et al. 2009, Clevers 2011, Visvader2011, Moncharmont et al. 2012, Pylväs-Eerola et al. 2016).The proportion of these cancer stem-like cells or cancerinitiating cells in tumors is generally less than 2% (Tanget al. 2007). Compared to other cells, these cancer stemlike cell populations are more tumorigenic, metastatic,invasive, prone to angiogenic switch and resistance tochemotherapy and radiotherapy (Bapat et al. 2005, Wu &Alman 2008, Crea et al. 2009, Ahmed et al. 2010, Visvader2011, Moncharmont et al. 2012, Steg et al. 2012). Themultipotent cancer stem-like cells with these propertiesdrive histologic heterogeneity within the tumors (Parket al. 2010). The high incidence of disease recurrence mayalso contribute to the multidrug resistance and multiplehistological phenotypes of the multipotency of stem celllike properties (Raghavan et al. 2017). Chitinase-3-likeprotein 1 (CHI3L1 or YKL-40) is a secreted glycoproteinwith a molecular weight of about 40 kDa. It is a memberof the glycosyl hydrolase 18 family, lacks chitinaseactivity, and is produced by the various types of cells,including inflammatory cells and cancer cells (Libreros &Iragavarapu-Charyulu 2015, Wiley et al. 2015). Expressionlevels of CHI3L1 in serum or tissues positively correlatewith various types of cancer, including ovary, lung, breastand brain (Johansen et al. 2004, Park et al. 2010, Ku et al.2011, Chiang et al. 2015a), and with several inflammatoryor autoimmune diseases, including coronary artery disease,diabetes mellitus and rheumatoid arthritis (Kazakova et al.2013, Hansen et al. 2015, Wiley et al. 2015). CHI3L1 ishypothesized to play a role in cancer cell proliferation,migration, invasion and metastasis. Although CHI3L1can be a marker associated with a poorer clinical outcomeof different tumors, its biologic functions and possiblemechanisms of action remain under investigation.Our previous study identified that ovarian canceroustissues expressed higher CHI3L1 than ovarian benign andhttps://erc.bioscientifica.com https://doi.org/10.1530/ERC-18-0300 2019 Society for EndocrinologyPublished by Bioscientifica Ltd.Printed in Great BritainCHI3L1 induces cancer stemlike cell properties26:174normal tissues (Chiang et al. 2015a). Besides, CHI3L1was associated with poor prognosis of advanced-stageovarian cancer patients (Chiang et al. 2015a). To explorethe possible biological functions of CHI3L1 in this cancer,we hypothesized that CHI3L1 could promote its cancerstem-like cell properties. We first found that RNA levelsof CHI3L1 in CA5171 ovarian cancer stem-like cellswere 3-fold higher than those in CA5171 parental cells.Moreover, CA5171 spheroid cells are more chemoresistantand prone to tumorigenesis than their parental cells.CHI3L1 promotes properties of ovarian cancer stem-likecells, including generating larger and more numbers oftumor spheroids, higher percentages of ALDH tumorcells, and resistance to cytotoxic drug-induced apoptosis.CHI3L1 could induce both of the Akt (essential) andErk signaling pathways, and then enhances expressionof β-catenin followed by SOX2, and finally promotestumor spheroid formation and the various properties ofovarian cancer stem-like cells. In vivo, OVCAR3 CHI3L1overexpressing transfectants were more tumorigenic,whereas CA5171 CHI3L1-knockdown transfectants wereless tumorigenic. Our findings suggest that CHI3L1 andits related axis (CHI3L1-β-catenin-SOX2) may provide apromising target for the treatment of ovarian cancer.Materials and methodsPatients and specimensFrom 2000 Jan to 2016 Jun, 113 women with advancedstage (stages III and IV) ovarian carcinoma treated in ourinstitute were enrolled. The Institutional Review Board ofthe hospital approved the study protocol and the patientsprovided informed signed consent after Jun, les at 58 C, as described (Chiang et al.2015a). Analysis of PCR products was performed byelectrophoresis (1% agarose gel with ethidium bromide)(Sigma) staining in TBE (a buffer mixture of Tris base,boric acid and EDTA) solution.https://erc.bioscientifica.com https://doi.org/10.1530/ERC-18-0300 2019 Society for EndocrinologyPublished by Bioscientifica Ltd.Printed in Great BritainEnzyme-linked immunosorbent assayELISA was performed to evaluate CHII3L1 concentrationsin various cancer cell media. Cells (2.5 105 cells/mL) wereseeded in a six-well culture plate and incubated for 48 h.Culture media were then collected and detected usingELISA kits (R&D Systems).ImmunoblottingImmunoblotting assays were performed to detect variousexpression levels of CHI3L1, stemness-related proteinsand signaling pathway proteins in OVCAR3, CA5171 andtheir transfectant cells. To measure alterations in stemnessgene expression during spheroid formation, cancer cells(1 106 cells/mL) were suspended in six-well Ultra LowAttachment plates (Corning) and incubated for 48 hfor spheroid formation. Spheroids were harvested andlysed in protein extraction buffer containing proteinaseK inhibitor. The BCA Protein Assay Kit (Thermo FisherScientific) was used to quantify protein extracts. Equalamounts of protein were resolved on 10% SDS-PAGEgels, transferred to a PVDF/nylon membrane (EMDMillipore) and probed with Abs specific to α-tubulin(Abcam), β-catenin (Abcam), CHI3L1 (R&D Systems),Nanog (OriGene Technologies, Rockville, MD, USA) andSOX2 and Oct-4 (Cell Signaling). The membrane was thenincubated with HRP-conjugated rabbit anti-mouse (HycultBiotechnology, Uden, Netherlands) and goat anti-mouse(R&D Systems) secondary Abs. The ECL western blottingsystem (Perkin Elmer) was used to visualize specific bands,Downloaded from Bioscientifica.com at 01/17/2022 03:49:54AMvia free access

Endocrine-RelatedCancerH-W Lin et al.and ImageQuant 5.0 software (Molecular Dynamics Inc.,Sunnyvale, CA, USA) was used to measure protein levelsthrough densitometric analysis.For signaling pathways involved in the spheroidformation, OVCAR3 tumor cells were seeded in six-wellUltra Low Attachment plates under stem cell conditions asdescribed earlier and treated with various concentrationsof recombinant human CHI3L1 protein (R&D Systems)for 30 min. To evaluate the phosphorylation of variousproteins, Phospho-p44/42 MAPK, Phospho-Jnk, p44/42MAPK, Akt, JNK (all from Cell Signaling) and phosphoAkt (Santa Cruz Biotechnology) were used as primaryAbs, and HRP-conjugated rabbit anti-mouse (HycultBiotechnology) was used as the secondary Ab.In the signal transduction pathways blockadeassays, OVCAR3 cells cultured in Ultra Low Attachmentplates under stem cell conditions were first treated withthe respective inhibitor (PD98059, 50 µM; LY294002,50 µM; Sigma-Aldrich) for 2 h, followed by exposureto recombinant human CHI3L1 protein for 30 min.Cells were then extracted and immunoblotted to detectexpression of the respective molecules in various signalingpathways, as previously described.Generation of overexpressing and knockdown CHI3L1in ovarian cancer cell linesThe lentivirus-packaging plasmids, PLKO AS3w.puro,Δ8.91 and pMD.G were purchased from the NationalRNAi Core Facility (Academia Sinica, Taiwan). Fulllength CHI3L1 was first generated by PCR usinghuman placenta cDNA as the template and thefollowing set of primers: sense, Hu-CHI3L1 S e,(PstI)Hu-CHI3L1 ASPstITAACTGCAGCTCAGCCTGGGACTCAGCA(PCRconditions). The results were cloned into the NheI/PstIsites of PLKO AS3w.puro vector, designated as pLKO AS3wCHI3L1.puro. To generate CHI3L1 lentivirus, 293T cellswere co-transfected with three plasmids, pLKO AS3wCHI3L1.puro, Δ8.91 and pMD.G, in a total transfectionvolume of 6 mL of Opti-MEM medium containingLipofectamine2000 reagent in 10 cm dishes and incubatedat 37 C under 5% CO2 for 48 h (Chiang et al. 2015a).To generate the CHI3L1-overexpressing OVCAR3transfectants, OVCAR3 cells were infected by CHI3L1lentivirus in culture medium with polybrene (10 µg/mL)and incubated at 37 C under 5% CO2 for 48 h (Chianget al. 2015a). The PLKO AS3w.puro was used to generatethe blank lentivirus as the negative control. To selecthttps://erc.bioscientifica.com https://doi.org/10.1530/ERC-18-0300 2019 Society for EndocrinologyPublished by Bioscientifica Ltd.Printed in Great BritainCHI3L1 induces cancer stemlike cell properties26:177stable CHI3L1-overexpressing OVCAR3 transfectants,puromycin (3 µg/mL) was added to the culture mediumand incubated at 37 C under 5% CO2 for more than48 h. The puromycin-resistant 3L1-C4andOVCAR3/CHI3L1-C9 were individually picked, expandedand used in the subsequent experiments.To generate CHI3L1-knockdown CA5171 transfectants,CHI3L1 shRNA plasmid was purchased from the NationalRNAi Core Facility (Academia Sinica, Taiwan). The CHI3L1shRNA lentivirus was generated by co-transfection withshRNA plasmid and Δ8.91 and pMD.G in Opti-MEMmedium containing Lipofectamine2000 and incubated at37 C under 5% CO2 for 48 h (Chiang et al. 2015a). ThePLKO AS3w.puro was used to generate the blank lentivirusas the negative control. CA5171 cancer cells were infectedby CHI3L1 shRNA lentivirus in culture medium withpolybrene (10 µg/mL) and incubated at 37 C under 5%CO2 for 48 h. For selecting stable CHI3L1-knockdownCA5171 transfectants, puromycin (3 µg/mL) was added tothe culture medium and incubated at 37 C under 5% CO2for more than 48 h. The puromycin-resistant CHI3L1knockdown CA5171 transfectants, CA5171/shCHI3L1-S1and CA5171/shCHI3L1-S2, were individually picked,expanded and used in the subsequent experiments.Transfection of siRNA (small interfering RNA)siRNA for SOX2 and CTNNB1 (β-catenin) was designed byand purchased from OriGene Technologies Inc. (Rockville,MD, USA). The duplex sequence of SOX2 was UrArUAA, and the duplex sequence of CTNNB1 (β-catenin)was SR301063A-rGGAUCACAAGAUGGAAUUUAUCAAA.The negative control was the siRNA duplex carrying a27-mer scrambled sequence from OriGene’s siRNA genespecific products. OVCAR3 and CHI3L1-overexpressingOVCAR3 transfectants were seeded in 6-well cultureplates (Corning) overnight and then transfected withsiRNA SOX2 or siRNA CTNNB1 (β-catenin) in a finalconcentration of 100 nM using Lipofectamine 2000transfection reagent (Invitrogen) and in a total of 2 mL ofserum-free RPMI 1640 medium. After incubation at 37 C,5% CO2 for 12 h, 2 mL of RPMI 1640 medium containing20% FBS was added. All cells were harvested and preparedfor the subsequent experiments.Statistical analysisSPSS version 15.0 (SPSS Inc) was used for data analysis.Statistical analyses were carried out using Kruskal–WallisDownloaded from Bioscientifica.com at 01/17/2022 03:49:54AMvia free access

Endocrine-RelatedCancerH-W Lin et al.or one-way ANOVA test. Survival curves were generatedusing the Kaplan–Meier method, and differences insurvival curves were calculated using the log-rank test.A P value 0.05 was considered to indicate statisticalsignificance.Ethics approval and consentAnimal handling and procedures were approved by theanimal ethic committee of College of Medicine, NationalTaiwan University (20160416). The Institutional ReviewBoard of the National Taiwan University Hospitalapproved the study entitled ‘Screening and identificationof novel diagnostic and prognostic biomarkers on ovariancancers’ (200706002R) to collect the human tissues afteracquiring the informed consents.ResultsHigh mRNA expression level of CHI3L1 correlatedwith chemoresistance and shorter DFS and OSThe clinicopathological characteristics of these casesare shown in Table 1. The mean follow-up duration was39.0 months. The serous type was 75% (85/113) and tumorgrade 3 was 92% (104/113) in all cases. The percentage ofoptimal debulking in all case was 50%. The median mRNAexpression level of the CHI3L1 was 7.6 (range 0.0–668.0).Chemoresistant patients had the higher median ofCHI3L1 mRNA level (18.5 16.3 vs 4.3 2.5, Kruskal–Wallis test, P 0.001, Fig. 1A) than chemosensitivepatients. Besides, high CHI3L1 group ( 7.6) had both ofshorter DFS (Fig. 1B) and OS (Fig. 1C) than low CHI3L1group (log-rank test, P 0.001).CHI3L1 induces cancer stemlike cell properties26:178Based on the clinical and outcome results, wehypothesized that the biologic role of CHI3L1 in ovariancancer is to promote ovarian cancer stem cell formation.Characteristics of CA5171 cancer stem-like cells inparental and spheroid cellsRepresentative figures of CA5175 parental cells andCA5171 spheroids are shown in Fig. 2A. Figure 2B showsrepresentative results for side-population assays by flowcytometry. The percentages of CA5171 parental cellspumping out Hoechst33342 decreased from 2.8 to 0.7%under verapamil treatment. The estimated proportion ofstem-like cells of the parental CA5171 line was around2.1% by side-population assays.CA5171 parental cells and spheroids expressingaldehyde dehydrogenase (ALDH) were further evaluated.As shown in Fig. 2C, 3.8% of CA5171 parental cellsexpressed ALDH, whereas 55% of CA5171 spheroid cellsdid so. These results indicated that percentages of cancerCA5171 stem-like cells increased by changing the culturemedia from regular medium to stem cell culture medium.Spheroid cells are more chemoresistant to cytotoxicdrugs and tumorigenesis than are their parental cellsThe chemoresistant capabilities between CA5171 parentalcells and spheroids were also evaluated. The IC50 forpaclitaxel in CA5171 parental cells was around 0.11 μM(Fig. 2D) whereas for CA5171 spheroid cells, it was 1 μM.In addition, the IC50 values for cisplatin in CA5171parental cells and their spheroid cells were 172.3 and604.2 μM, respectively (Fig. 2D).Figure 1Correlation between the mRNA expression levels of CHI3L1 and chemoresistance and outcome of 113 ovarian cancer patients. (A) Correlation betweenthe mRNA expression levels of CHI3L1 and chemoresistance. Chemoresistant patients had higher levels of CHI3L1 than chemosensitive patients (18.5 vs4.3, P 0.001, Kruskal–Wallis test). (B) Correlation between mRNA expression levels of CHI3L1 and disease-free survival (DFS) of patients. The high CHI3L1group had shorter DFS than low CHI3L1 group (P 0.001, Log-rank test). (C) Correlation between mRNA expression levels of CHI3L1 and overall survival(OS) of patients. The high CHI3L1 group had shorter OS than low CHI3L1 group (P 0.001, Log-rank test).https://erc.bioscientifica.com https://doi.org/10.1530/ERC-18-0300 2019 Society for EndocrinologyPublished by Bioscientifica Ltd.Printed in Great BritainDownloaded from Bioscientifica.com at 01/17/2022 03:49:54AMvia free access

Endocrine-RelatedCancerH-W Lin et al.CHI3L1 induces cancer stemlike cell properties26:179Figure 2Characteristics of CA5171 cancer stem-like cells.(A) Representative images of CA5171 parentalcells and spheroids in low- (40 ) and high- (200 )power fields photographed using an invertedphase-contrast microscope. CA5171 parental cellscould be cultured to CA5171 spheroids understem cell conditions. (B) Side-population assays ofCA5171 parental cells treated with DMSO orverapamil (100 µM), stained with Hoechst 33342dye, and then analyzed by flow cytometry. Thepercentages of CA5171 parental cells pumpingout Hoechst33342 decreased from 2.8 to 0.7%under verapamil treatment. (C) ALDH CA5171parental cells and spheroids stained in Aldefluorassays. 3.8% of CA5171 parental cells expressedALDH compared to 55% of CA5171 stem-like cells.(D) Cytotoxicities of CA5171 parental cells andspheroids treated with cytotoxic drugs by MTTassays. CA5171 spheroids had significantly higherIC50 concentrations compared to parental cellsunder either paclitaxel or cisplatin treatment. (E)In vivo tumor growth experiments with CA5171parental cells and its spheroids. Cell numbers forin vivo tumorigenesis were fewer

Han-Wei Lin1, Ying-Cheng Chiang 2, Nai-Yun Sun1, Yu-Li Chen, Chi-Fang Chang 2, Yi-Jou Tai, Chi-An Chen2 and Wen-Fang Cheng1 ,2 3 1Graduate Institute of Oncology, National Taiwan University, Taipei, Taiwan 2Department of Obstetrics a

Related Documents:

Country: Viet Nam Initiation Plan Project Title: For preparation and implementation of Project on Leveraging Viet Nam's Social Impact Business Ecosystem in Response to COVID-19 (ISEE-COVID) Expected UNDAF/CP Outcome(s): Outcome 1.1; Outcome 2.1; Outcome 4.1 Expected CPD Output(s): Outcome 1; Outcome 2; Outcome 3 Initiation Plan Start/End Dates: 20 May 2021 - 20 August 2021 (3 months)

Poor air distribution Poor humidity control VAV Problems Solved with DOAS/Parallel FCU Poor acoustical properties Poor use of plenum and mechanical shaft space Serious control problems, particularly with tracking return fan systems Pd 18 Poor energy transport medium: air Poor resistance to the threat of biological and chemical terrorism

The results indicated that M2 macrophages are recruited by tumor cells. The M2-secreted chitinase 3-like protein 1 (CHI3L1) promoted the metastasis of gastric and breast cancer cells by triggering the mitogen-activated protein kinase (MAPK) signaling pathway. Therefore, our

management (Cavus & Sharif, 2014; Degeng, 1989). Meanwhile, learning outcome is explained by two dimensions, precisely, actual outcome and desired outcome. Talking about actual outcome, it is defined as outcome that has been achieved through the use of certain strategy on certain condition (Hartini et al., 2017).

Global learning algorithms One feature vector per outcome Each outcome scored Prediction highest scoring outcome Structured classification Global models or local models Each outcome scored Prediction highest scoring outcome Inference is no longer easy! Makes all the difference

graphical comparison of an agency's actual outcome (1) with its expected outcome (using a "national" comparison group) and (2) with its risk-adjusted outcome for the prior year. An enumeration of the outcome measures with a brief rationale for why the current group of 41 outcomes was selected is provided in Section 5 of this document.

Oct 19, 2010 · by the poor, because basic services are highly valued by the poor. Since the typical median voter is poor, election results should reflect their preferences for higher public service provision (Meltzer & Richard 1981, Wittman 1989, Gradstein 1993). A similar theme is echo

3039/D 3039M untuk pengujian tarik dan ASTM D 4255/D 4255M-83 untuk pengujian geser. Serat rami yang digunakan adalah serat kontinyu dengan kode produksi 100% Ne 14’S, menggunakan matriks berupa .