Research Article Is Hydrogen Peroxide A Suitable Apoptosis .
Hindawi Publishing CorporationBioMed Research InternationalVolume 2016, Article ID 7343965, 6 h ArticleIs Hydrogen Peroxide a Suitable ApoptosisInducer for All Cell Types?Jinmei Xiang,1,2 Chunyun Wan,1,3 Rui Guo,4 and Dingzong Guo11College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070, ChinaHubei Vocational College of Bio-Technology, Wuhan, Hubei 430070, China3College of Animal Science, Yangtze University, Jingzhou, Hubei 434023, China4Hubei Academy of Agricultural Sciences, Wuhan, Hubei 430070, China2Correspondence should be addressed to Dingzong Guo; hlgdz@163.comReceived 9 May 2016; Accepted 11 July 2016Academic Editor: Emanuele MarzettiCopyright 2016 Jinmei Xiang et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Hydrogen peroxide is currently the most widely used apoptosis inducer due to its broad cytotoxic efficacy against nearly all cell types.However, equivalent cytotoxicity is achieved over a wide range of doses, although the reasons for this differential sensitivity are notalways clear. In this study, three kinds of cells, the 293T cell line, primary fibroblasts, and terminally differentiated myocardial cells,were treated with a wide range of H2 O2 doses. Times to apoptosis initiation and end were measured cytochemically and the changesin expression of caspase-9, P53, NF-đ B, and RIP were determined by RT-PCR. The 293T cell line was the most sensitive to H2 O2 ,undergoing necroptosis and/or apoptosis at all concentrations from 0.1 to 1.6 mM. At 0.4 mM, H2 O2 also caused necroptosis inprimary cells. At 0.4 mM, however, primary cells exhibited classic signs of apoptosis, although they tended to survive for 36 hoursin 0.2 mM H2 O2 . Thus, H2 O2 is a broadly effective apoptosis inducer, but the dose range differs by cell type. For cell lines, a lowdose is required and the exposure time must be reduced compared to primary cells to avoid cell death primarily by necroptosis ornecrosis.1. IntroductionCell apoptosis was first described as a cell death pathwayunique from necrosis in 1972 [1]. Thereafter, a plethoraof apoptosis inducers were identified, such as hydrogenperoxide (H2 O2 ), dithiothreitol (DTT), and oxidized LDL [2â4]. Among these agents, H2 O2 has been the most widely usedand studied at the mechanistic level. In many cases, transientexposure to H2 O2 triggers apoptosis through the mitochondrial pathway involving sequential loss of mitochondrialmembrane potential, cytochrome c release, and effectorcaspase-3 activation [5â7]. Several factors that can antagonizeapoptosis induced by H2 O2 have also been identified, suchas nerve growth factor (NGF) and chlorogenic acid [8, 9].Hydrogen peroxide is used as an apoptosis inducer for manytypes of cells, including cell lines, tumor cells, primary cells,and highly differentiated cells [10â15], although the dosesused vary widely, from 0.05 to 10 mM [12â14, 16, 17]. Asthere are several interacting but mechanistically distinct celldeath pathways that may be activated by H2 O2 , it is critical toidentify the ranges over which these pathways are primarilyactivated. Moreover, such information could yield valuableinformation on the interactions among these pathways undercell stress. To date, however, there is still no study that systematically studied different susceptibility to H2 O2 -inducedapoptosis among cell types, which is critical for determiningif H2 O2 is a suitable apoptosis inducer in a specific context.Indeed, whether apoptosis or necroptosis is induced underdifferent dosages of H2 O2 is often unconfirmed [18] andapoptosis is only assumed.Certain indices can reveal specific aspects of the cell deathprocess. For example, caspase-9 can be used to monitor theinitiation of apoptosis [19], activation of NF-đ B is usuallycaused by oxidative stress and may indicate DNA damage[20], and P53 can indicate dysregulation of the cell cycleand proliferation [21]. RIP is a key mediator of necroptosissignaling pathways; therefore RIP can be used to distinguishapoptosis from necroptosis [22].
2BioMed Research InternationalTable 1: Primers for quantitative real-time PCR.GeneForwardReverseThermocycle Caspase-95 TCAGACATCGTATCCTCCA5 AGTCACAGCAGCACAP535 ACCTGCACTTACTCCCCGGT5 TCTTATAGACGGCCACGGCG F/CNF-đ B 5 AGGACTTAAAATGGCAGGAGAG 5 GCTGTTCGTAGTGGTAAGTCTG 98 C/3 min 40 [98 /15 s; 61 C/40 s]RIP15 GAACTAGGCTTCAGCAACTCCG 5 GCAGCCAAAGAGGGCTTTGGđ˝-actin5 GGCACCCAGCACAATGAAG5 CCGATCCACACGGAGTACTTGCaspase-95 TGCTGAGCAGCGAGCTGTT5 AGCCTGCCCGCTGGAT P535 CCACCATCCACTACAACTACAT5 CAAACACGGACAGGACCC293T NF-đ B98 C/3 min 40 [98 /15 s; 61 C/40 s]5 TCATAGAAGCCATCCCGGC5 TCTCCCTGGTCACCAAGGAC5 ACTTCCCTCAGCTCATTGTGRIP15 CATGGAAAAGGCGTGATACAC 5 CCGATCCACACGGAGTACTTGđ˝-actin5 GGCACCCAGCACAATGAAGF/C: fibroblasts/cardiomyocytes.To determine if H2 O2 is a suitable apoptosis inducer fora given cell type, we measured cytochemical and geneticindices of apoptosis and necroptosis under a range ofH2 O2 doses in three cell types, an immortalized cell line,primary fibroblasts, and terminally differentiated cardiomyocytes. These cells were chosen for their distinct proliferativefeatures. The 293T immortalized cell line is characterizedby unlimited proliferation and passages, while fibroblastsshow limited proliferation and passages, and terminallydifferentiated cardiomyocytes show no further proliferation.For convenience, both fibroblasts and myocardial cells werederived from chicken embryos.2. Materials and Methods2.1. Cell Culture. Isolation and culture of chicken embryofibroblasts and myocardial cells followed methods previouslydescribed [23, 24] with some modifications. Briefly, WhiteLeghorn eggs were obtained from Beijing Merial Vital Laboratory Animal Technology (Beijing, China). At embryonicday 11 (E11), embryos were removed and decapitated in a Petridish filled with Medium 199/EBSS (HyClone, Logan, Utah,USA) supplemented with 3% fetal bovine serum (FBS, Gibco,Grand Island, New York, USA). Ventricular tissues and torsoof chicken embryo were isolated for the preparations ofmyocardial cells and CEF and treated with 0.05% trypsinEDTA to obtain a cell suspension as described [14, 25, 26],respectively. Specifically, the cells of CEF and myocardial cellswere, respectively, incubated at 8 105 per well in 24-wellplates in growth medium (Medium 199/EBSS containing 10%FBS) at 37 C under a 5% CO2 atmosphere. Cultures werewashed three times at 8, 24, and 48 h to remove dead anddying cells. The serum concentration in the medium was thenchanged from growth (10%) to maintenance (2%) conditions.293T cells at low passage were incubated at 1 105cells/well in 24-well plates with Dulbeccoâs modified Eaglemedium (DMEM) (HyClone, Logan, Utah, USA) containing10% FBS at 37 C under a 5% CO2 atmosphere. After plating,the serum concentration was decreased from growth (10%) tomaintenance (2%) conditions.2.2. Apoptosis Induction and Assessment. Each cell type wasdivided into three groups, H2 O2 treatment, positive control(DTT treatment), and negative control. H2 O2 groups wereincubated in 0.1, 0.2, 0.4, 0.8, or 1.6 mM H2 O2 , the positivecontrol groups were incubated in 2 mM DTT, and thenegative control groups received no treatment. After the startof exposure, cells were examined every 0.5 h by staining withAO/EB to monitor the initiation of apoptosis. DAPI stainingwas used to determine the time to substantial apoptosis.Then, apoptosis times and cell survival rates were determinedby AO/EB staining and DAPI staining. Finally, total RNAwas extracted from cells using Trizol reagent (Invitrogen,Carlsbad, CA, USA) to assess expression levels of apoptosisand necroptosis-associated genes. Reverse transcription wasperformed using a PrimeScript II 1st Strand cDNA synthesiskit (TaKaRa, Otsu, Shiga, Japan). Quantitative real-time PCRwas conducted to evaluate changes in caspase-9, P53, NF-đ B,and RIP expression levels using the primers and thermocycleconditions shown in Table 1. Group means were compared byANOVA using SPSS17.0 software. All bar figures were createdby Graphpad Prism 5 software.3. Results3.1. Initiation Time of Apoptosis. Apoptosis initiation times atdifferent H2 O2 doses are shown in Figure 1 for all three celltypes. The time to initiation was estimated by AO/EB doublestaining every 0.5 h under an inverted epifluorescence microscope. The 293T cells were very sensitive to both DTT- andH2 O2 -induced apoptosis as indicated by the shorter delaysuntil initiation compared to the other cell types. Alternatively,apoptosis initiation times did not differ significantly betweenmyocardial cells and fibroblasts in response to DTT or H2 O2 .3.2. Significant Differences in Times to Substantial Apoptosisand the End of Apoptosis among Cell Types. After apoptosisstarted, DAPI staining was used to determine the time atwhich significant apoptosis occurred (Figure 2). At 0.4 mMH2 O2 , apoptosis developed rapidly with little differencebetween cell types. At 0.4 mM, however, the time tosubstantial apoptosis was much more sensitive to H2 O2
BioMed Research International340Time to end of apoptosis in responseto hydrogen peroxide and DTT F0.81.6DTT2Figure 2: Time to significant apoptosis induction for each cell typein response to DTT or hydrogen peroxide. Hydrogen peroxide, 0.1â1.6 mM; DTT, 2 mM; T, 293T cells; M, myocardial cells; F, fibroblasts.dose and cell type, with markedly faster times for 293Tcells, particularly at 0.4 mM, compared to fibroblasts andcardiomyocytes. For the apoptosis ending test, the medium(both control and medium containing H2 O2 ) was replacedevery 12 hours to prevent a decrease in inducer concentration.Apoptosis ending was observed for up to 36 hours (Figure 3)and indicated that primary cells (fibroblasts and cardiomyocytes) can survive at 0.2 mM for 36 h.3.3. Changes in Expression of Apoptosis Indicators. Afterapoptosis became significant, the RNA of each cell groupwas extracted and reverse-transcribed for real-time PCRanalysis of caspase-9, P53, NF-đ B, and RIP expression levels.F0.81.6DTT2Figure 3: Time to end of apoptosis in response to hydrogen peroxideand DTT. Hydrogen peroxide, 0.1â1.6 mM; DTT, 2 mM; T, 293Tcells; M, myocardial cells; F, fibroblasts.Expression of apoptosis andnecroptosis indices in 293T cells (h)15TM0.10.20.4Figure 1: Time to apoptosis initiation. 293T cells (T), myocardialcells (M), and fibroblasts (F) were treated with a range of hydrogenperoxide concentrations (0.1â1.6 mM) or DTT (2 mM, positivecontrol).Time to significant apoptosis inductionfor each cell type in response toDTT or hydrogen peroxide (h)30108 642 80.40.20.1CDTT21.60.80.40.20.1CTimes to apoptosis initiation (h)10Caspase-9P53NF-đ BRIP1Figure 4: Expression of apoptosis and necroptosis indices in293T cells. Hydrogen peroxide, 0.1â1.6 mM; DTT, 2 mM. Each barrepresents the means SD (n 3). đ 0.01; đ 0.05 comparedwith control.In 293T cells (Figure 4) caspase-9, P53, and NF-đ B increasedat all H2 O2 concentrations. In general, expression rose withincreasing concentration but the peak differed for caspase9, P53, and NK-đ B (0.6 or 0.8 mM). The trend for RIP wasdistinct; RIP was induced at all H2 O2 concentrations, incontrast to the expression pattern in fibroblasts (Figure 5) andcardiomyocytes (Figure 6).Hydrogen peroxide- and DTT-induced changes in fibroblast expression of apoptosis- and necroptosis-associatedgenes are shown in Figure 5. Compared to 293T cells, therewere differences in the magnitude of the expression increases,but the general trends were similar. A notable exception wasthe higher threshold concentration for upregulation of thenecroptosis indicator RIP.Changes in expression also followed similar trends inmyocardial cells (Figure 6) although NF-đ B expression was
BioMed Research International20 15105 80.40.20.1CDTT21.60.80.40.20.1CExpression of apoptosis andnecroptosis indices in fibroblast (h)4Caspase-9P53NF-đ BRIP140 30 2010 0 0.40.20.1CDTT21.60.80.40.20.1CExpression of apoptosis and necroptosisindices in myocardial cells (h)Figure 5: Expression of apoptosis and necroptosis indices infibroblasts. Hydrogen peroxide, 0.1â1.6 mM; DTT, 2 mM. Each barrepresents the means SD (n 3). đ 0.01 compared withcontrol.Caspase-9P53NF-đ BRIP1Figure 6: Expression of apoptosis and necroptosis indices inmyocardial cells. Hydrogen peroxide, 0.1â1.6 mM; DTT, 2 mM. Eachbar represents the means SD (n 3). đ 0.01; đ 0.05compared with control.lower with no trend for dose-dependence. Moreover, similarto fibroblasts and in contrast to 293T cells, RIP expression wasnot upregulated by the lowest H2 O2 concentrations.4. DiscussionThe three cell types examined showed clear differences insensitivity to apoptosis induction by hydrogen peroxide andDTT. We speculated that highly proliferative cells wouldshow the strongest apoptosis resistance, followed by primarycells and then highly differentiated cells. However, the exactopposite proved to be the case, with 293T cells showingthe fastest apoptosis induction across H2 O2 concentrations,as well as the shortest time to substantial induction, andthe earliest end of induction compared to fibroblasts andcardiomyocytes. Moreover, the induction of apoptosis indiceswas accompanied by upregulation of RIP, a gene associatedwith necroptosis, at all H2 O2 concentrations. Alternatively,terminally differentiated myocytes with no proliferativecapacity showed minimal induction of apoptosis at concentrations inducing substantial apoptosis/necroptosis in 293Tcells. In addition, internal ROS production may be differentfrom one cell type to another and H2 O2 produced duringnormal cell metabolism and production must be higherin rapidly proliferative cells. Therefore, H2 O2 concentrationused should be chosen carefully according to cell model instudies of apoptosis as the induction range differs markedlyamong cell types.The necroptosis index RIP was induced by low concentrations of H2 O2 (0.1 and 0.2 mM) only in 293T cells, whileRIP induction required 0.4 mM or higher in fibroblasts andcardiomyocytes. Thus, H2 O2 concentrations of 0.2â0.4 mMare appropriate for studying âpureâ apoptosis in fibroblastsand cardiomyocytes. In contrast, very low doses may berequired to study âpureâ apoptosis in 293T cells. Therefore,if an inadequate dosage was used for specific cell types, theapoptosis inducing effect of H2 O2 would not be observed andthe appropriate dosage for inducing the apoptosis of specificcell types should be determined firstly. The series of measurements conducted here constitute a template for determiningthe optimal H2 O2 concentration range for specific analysis ofapoptosis (i.e., in the absence of necrosis or necroptosis) fora given cell type.4.1. Efficiency of Hydrogen Peroxide. In our experiments, ahydrogen peroxide dosage was 0.4 mM evoked rapid andrelatively uniform cell death, while the extent of cell deathwas highly dose-sensitive 0.4 mM. At 0.1 and 0.2 mM,fibroblasts and cardiomyocytes survived for 36 hours, whilesubstantial death of 293T cells was observed. Cell lineshave a higher cell death efficiency induced by hydrogenperoxide. For all the cells, the starting time of apoptosiswas dose-dependent; the higher dosage inducer had a fastercell death. In this experiment, we first wanted to use flowcytometry for assessment, but there were some interferences,especially in primary cells, for dregs can be easily stainedand thus interfere with the assessment. Therefore, we used afluorescence inversion microscope system.4.2. Factors Controlling Susceptibility to Hydrogen Peroxide.It was found that cell density in a 24-well plate and thegeneration number of 293T cells has a significant impacton the beginning and ending times of apoptosis. If the cellline has a high generation or density, it would be moresensitive to the induction by hydrogen peroxide. So wedecreased the number of the three kinds of cells per wellduring the incubation. The beginning and ending timesof apoptosis were used to determine cell susceptibility tohydrogen peroxide. Unexpectedly, it was found that cell linesare the most sensitive to hydrogen peroxide. Even at the lowerdosage, hydrogen peroxide may cause the apoptosis of 293Tcells, and apoptosis can occur earlier and faster than the other2 kinds of cells.4.3. Cell Death Type after Induction with Hydrogen Peroxide.In the experiments, 4 indices were used to monitor the
BioMed Research Internationalchanges in cells after induction with hydrogen peroxide. Asjudged by RIP, it was found that 293T cells may be involvedin necroptosis, even at a low dosage. Thus, if we want toinduce cell lines into apoptosis, we must reduce the actiontime or use DTT to induce apoptosis. For myocardial cellsand fibroblasts, they tend to be involved in necroptosis only ata higher dosage. From the other 3 indices, it can be concludedthat 3 kinds of cells have different responses to the inductionby hydrogen peroxide, which showed that fibroblasts are notinclined to necroptosis after induction from the expressionof RIP. For other indices, fibroblasts have a higher expressionof NF-đ B, which may indicate that it has had more DNAcorrosion and handicap of transcription. 293T cells havea higher expression of P53, indicating a disorder in cellcycle and proliferation. The myocardial cells have a higherexpression of all indices, which may be a comprehensiveeffect.In the experiments it was found that the cells underwentmorphologic changes after induction by hydrogen peroxideand it is dose-dependent. After the comparison of DTTand hydrogen peroxide, there are many differences in the 4indices; however, the trend is basically consistent. It was alsofound that the hydrogen peroxide can greatly influence cellmotor ability, but after the induction of DTT for 6 hours,the impulse of some myocardial cells still exists and theapoptosis effect is less than hydrogen peroxide. The existingquestion is whether or not hydrogen peroxide has a selectivityin different cell lines or if hydrogen peroxide has a speciesselectivity, such as cells from rats.5. ConclusionHydrogen peroxide has a high efficiency leading to cell death.Hydrogen peroxide causes necroptosis in 293T cells at aconcentration ranging from 0.1 to 1.6 mM. The cell lines usedin this study were sensitive to hydrogen peroxide. In primarycells, a concentration 0.4 mM may also cause necroptosis.A concentration 0.4 mM had a tendency to apoptosis.Primary cells can survive in hydrogen peroxide for 36 hoursat a concentration 0.2 mM. Different cells have a differentresponse to induction by hydrogen peroxide. Thus, hydrogenperoxide qualifies as an apoptosis inducer at a specific dosagecorresponding to the specific cell types, but researchers do notpay attention to these findings.Ethical ApprovalThis study was approved by the Animal Care and UseCommittee of Hubei Province, China. All animal procedureswere performed according to the guidelines developed byChinaâs Council on Animal Care.DisclosureThe funders had no role in the study design, data collection oranalysis, decision to publish, or the preparation of the paper.5Competing InterestsThe authors declare that they have no competing interests.Authorsâ ContributionsJinmei Xiang, Chunyun Wan, and Dingzong Guo conceivedand designed the experiments; Jinmei Xiang and ChunyunWan performed the experiments; Jinmei Xiang, ChunyunWan, and Rui Guo analyzed the data; Rui Guo contributedregents/materials/analysis tools; Jinmei Xiang and ChunyunWan wrote the paper. Jinmei Xiang and Chunyun Wancontributed equally to this work.AcknowledgmentsSpecial thanks are due to Li Liang and Li Youwen forapoptosis identification and technical assistance and to ZhangGuoxing for his help in cell culture and treatment. Thiswork was supported by a preliminary research project grantfrom Huazhong Agricultural University [52209-814112] andthe National Natural Sciences Foundation of China (no.31502132).References[1] J. F. Kerr, A. H. Wyllie, and A. R. Currie, âApoptosis: abasic biological phenomenon with wide-ranging implicationsin tissue kinetics,â British Journal of Cancer, vol. 26, no. 4, pp.239â257, 1972.[2] Q. Yating, Y. Yuan, Z. Wei et al., âOxidized LDL induces apoptosis of human retinal pigment epithelium through activation ofERK-Bax/Bcl-2 signaling pathways,â Current Eye Research, vol.40, no. 4, pp. 415â422, 2015.[3] L. Tartier, Y. L. McCarey, J. E. Biaglow, I. E. Kochevar, andK. D. Held, âApoptosis induced by dithiothreitol in HL-60cells shows early activation of caspase 3 and is independent ofmitochondria,â Cell Death and Differentiation, vol. 7, no. 10, pp.1002â1010, 2000.[4] E. R. Whittemore, D. T. Loo, and C. W. Cotman, âExposure tohydrogen peroxide induces cell death via apoptosis in culturedrat cortical neurons,â NeuroReport, vol. 5, no. 12, pp. 1485â1488,1994.[5] H. M. Viola, P. G. Arthur, and L. C. Hool, âTransient exposure tohydrogen peroxide causes an increase in mitochondria-derivedsuperoxide as a result of sustained alteration in L-type Ca2 channel function in the absence of apoptosis in ventricularmyocytes,â Circulation Research, vol. 100, no. 7, pp. 1036â1044,2007.[6] H.-Y. Lin, S.-C. Shen, C.-W. Lin, L.-Y. Yang, and Y.-C. Chen,âBaicalein inhibition of hydrogen peroxide-induced apoptosis via ROS-dependent heme oxygenase 1 gene expression,âBiochimica et Biophysica Acta (BBA)âMolecular Cell Research,vol. 1773, no. 7, pp. 1073â1086, 2007.[7] M. Singh, H. Sharma, and N. Singh, âHydrogen peroxideinduces apoptosis in HeLa cells through mitochondrial pathway,â Mitochondrion, vol. 7, no. 6, pp. 367â373, 2007.[8] T. Satoh, N. Sakai, Y. Enokido, Y. Uchiyama, and H. Hatanaka,âFree radical-independent protection by nerve growth factorand Bcl-2 of PC12 cells from hydrogen peroxide-triggered
1][22][23][24][25]BioMed Research Internationalapoptosis,â Journal of Biochemistry, vol. 120, no. 3, pp. 540â546,1996.Y. Y. Luo, M. Yin, Y. H. Wu, D. W. He, Q. Q. Wei, and C. C.Yin, âProtective effects of chlorogenic acid against hydrogenperoxide induced rat nucleus pulposus cells apoptosis,â ChineseTraditional Patent Medicine, vol. 4, pp. 656â660, 2013.J. Liu, Y. Wang, W. Du et al., âWnt1 inhibits hydrogen peroxideinduced apoptosis in mouse cardiac stem cells,â PLoS ONE, vol.8, no. 3, Article ID e58883, 2013.L. Wu, Z. Xi, R. Guo et al., âExogenous ARC down-regulatescaspase-3 expression and inhibits apoptosis of broiler chickencardiomyocytes exposed to hydrogen peroxide,â Avian Pathology, vol. 42, no. 1, pp. 32â37, 2013.I. Bejarano, J. Espino, A. M. Marchena et al., âMelatoninenhances hydrogen peroxide-induced apoptosis in humanpromyelocytic leukaemia HL-60 cells,â Molecular and CellularBiochemistry, vol. 353, no. 1-2, pp. 167â176, 2011.P. Pallepati and D. A. Averill-Bates, âMild thermotoleranceinduced at 40 C protects HeLa cells against activation ofdeath receptor-mediated apoptosis by hydrogen peroxide,â FreeRadical Biology and Medicine, vol. 50, no. 6, pp. 667â679, 2011.Z. Li, J. Zhao, Q. Li et al., âKLF4 promotes hydrogen-peroxideinduced apoptosis of chronic myeloid leukemia cells involvingthe bcl-2/bax pathway,â Cell Stress and Chaperones, vol. 15, no.6, pp. 905â912, 2010.G. F. Ribeiro, M. CoĚrte-Real, and B. Johansson, âCharacterization of DNA damage in yeast apoptosis induced by hydrogenperoxide, acetic acid, and hyperosmotic shock,â MolecularBiology of the Cell, vol. 17, no. 10, pp. 4584â4591, 2006.S.-J. Lee, H. Ahn, K.-W. Nam, K. H. Kim, and W. Mar, âEffectsof rutaecarpine on hydrogen peroxide-induced apoptosis inmurine hepa-1c1c7 cells,â Biomolecules and Therapeutics, vol. 20,no. 5, pp. 487â491, 2012.P. Roy, E. Reavey, M. Rayne et al., âEnhanced sensitivity tohydrogen peroxide-induced apoptosis in Evi1 transformed Rat1fibroblasts due to repression of carbonic anhydrase III,â TheFEBS Journal, vol. 277, no. 2, pp. 441â452, 2010.A. S. Ghosh, S. Dutta, and S. Raha, âHydrogen peroxideinduced apoptosis-like cell death in Entamoeba histolytica,âParasitology International, vol. 59, no. 2, pp. 166â172, 2010.M. L. WuĚrstle, M. A. Laussmann, and M. Rehm, âThe centralrole of initiator caspase-9 in apoptosis signal transduction andthe regulation of its activation and activity on the apoptosome,âExperimental Cell Research, vol. 318, no. 11, pp. 1213â1220, 2012.K. W. McCool and S. Miyamoto, âDNA damage-dependentNF-đ B activation: NEMO turns nuclear signaling inside out,âImmunological Reviews, vol. 246, no. 1, pp. 311â326, 2012.T. Li, N. Kon, L. Jiang et al., âTumor suppression in the absenceof p53-mediated cell-cycle arrest, apoptosis, and senescence,âCell, vol. 149, no. 6, pp. 1269â1283, 2012.A. Degterev, J. Hitomi, M. Germscheid et al., âIdentification ofRIP1 kinase as a specific cellular target of necrostatins,â NatureChemical Biology, vol. 4, no. 5, pp. 313â321, 2008.R. L. DeHaan, âDevelopment of form in the embryonic heart, anexperimental approach,â Circulation, vol. 35, no. 5, pp. 821â833,1967.Z. Xing and K. A. Schat, âExpression of cytokine genes inMarekâs disease virus-infected chickens and chicken embryofibroblast cultures,â Immunology, vol. 100, no. 1, pp. 70â76, 2000.K. A. Schat and H. G. Purchase, âCell-culture methods,â in ALaboratory Manual for the Isolation and Identification of AvianPathogens, D. E. Swayne, J. R. Glisson, M. W. Jackwood, J. E.Pearson, and V. W. M. Reed, Eds., p. 223, American Associationof Avian Pathologists, Kennett Square, Pa, USA, 4th edition,1998.[26] C. Wan, J. Xiang, Y. Li, and D. Guo, âDifferential gene expressionpatterns in chicken cardiomyocytes during hydrogen peroxideinduced apoptosis,â PLoS ONE, vol. 11, no. 1, Article IDe0147950, 2016.
International Journal ofPeptidesBioMedResearch InternationalHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Advances inStem CellsInternationalHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Hindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Virolog yHindawi Publishing Corporationhttp://www.hindawi.comInternational Journal ofGenomicsVolume 2014Hindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Journal ofNucleic AcidsZoologyInternational Journal ofHindawi Publishing Corporationhttp://www.hindawi.comHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Volume 2014Submit your manuscripts athttp://www.hindawi.comThe ScientificWorld JournalJournal ofSignal TransductionHindawi Publishing Corporationhttp://www.hindawi.comGeneticsResearch InternationalHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014AnatomyResearch InternationalHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014EnzymeResearchArchaeaHindawi Publishing Corporationhttp://www.hindawi.comHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Volume 2014Hindawi Publishing rch InternationalInternational Journal ofMicrobiologyHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014International Journal ofEvolutionary BiologyVolume 2014Hindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Hindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Molecular BiologyInternationalHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Advances inBioinformaticsHindawi Publishing Corporationhttp://www.hindawi.comVolume 2014Journal ofMarine BiologyVolume 2014Hindawi Publishing Corporationhttp://www.hindawi.comVolume 2014
from one cell type to another and H 2 O 2 produced during normal cell metabolism and production must be higher in rapidly proliferative cells. erefore, H 2 O 2 concentration used should be chosen carefully according to cell model in st
homolytic cleavage. Carbamide peroxide contains approximately 35% hydrogen peroxide and forms hydrogen peroxide and urea in liquid solution. 750,000 tonnes hydrogen peroxide (calculated as 100% H2O2) were produced in Europe in 1995. The main usage of hydrogen peroxide is in production of chemicals and bleaching of cellulose pulp and textiles.
Decontamination throughout hydrogen peroxide is broadly used not just in the pharmaceutical industry but also in hospitals, cleanrooms and the food industry. Therefore the delivery forms and methods are also broad: 1. Vaporized Hydrogen Peroxide 2. Micro-condensed Hydrogen Peroxide 3. Nebulized Hydrogen Peroxide
Hydrogen Peroxide.8 Pure Hydrogen Peroxide is a crystalline solid below 12 F (-11.11 C) and a colorless liquid with a bitter taste above 12 F.9 Hydrogen Peroxide can behave both as an oxidizing agent and as a reducing agent. Aqueous solutions containing 35%, 50%, 70%, or 90% Hydrogen Peroxide are the most commonly used solutions .
phase of the hydrogen peroxide (Vapor Hydrogen Peroxide, so called VHP) for a proper distribution and decontamination, using a formula of 35-40% w/v of hydrogen peroxide in water. The solution is stabilized and maintained in an acidic solution (pH 2,5-4,5) that ensures a certain shelf life. Other solutions, such as atomization of the hydrogen .
A 3% solution of Hydrogen Peroxide is sometimes called ten volume strength, (one volume of Hydrogen Peroxide releases ten volumes of oxygen when it decomposes). A pint of the food-grade 35% solution contains the equivalent of 130 pints of oxygen. A pint of 3% hydrogen peroxide found at a loca
If hydrogen peroxide solutions come in contact with eyes, severe injury or even blindness can result. Hydrogen peroxide will irritate and possibly cause chemical and/or thermal burns on the skin. Ingestion may be fatal. Decomposition of hydrogen peroxide generates heat and
physical state of the hydrogen peroxide escaping from the decontamination system. The VPHP system vaporises 30 35 % hydrogen peroxide aqueous solution to produce a mixture of air and hydrogen peroxide vapour, which can be considered with good approximation, a gaseous sys
Protect hydrogen peroxide from direct heat. Hydrogen peroxide as produced by SOLVAY INTEROX is very pure and the decomposition rate to water and oxygen is normally very low. However, if the hydrogen peroxide becomes contaminated e.g. with salts of metals such as iron, copper, ch
