Chapter 12: From DNA To Proteins UNIT 3

Chapter 12: From DNA to ProteinsUNIT 3I. Identifying DNA as the Genetic Material (8.1)A. Griffith finds a “transforming principle”1. Griffith experimented with thebacteria that cause pneumonia.Chapter 12Pneumococcus bacteriaFrom DNA to Proteins2. He used two forms and injected them into micea. The S, or smooth form (deadly)b. R form, or rough (not deadly).3. S form of bacteria killed with heat miceunaffected4. Injected mice with combination of heat-killedand live R bacteriaa. Mice diedb. Griffith concluded that a transformingmaterial passed from dead S bacteria to liveR bacteria, making them deadly.B. Avery identifies DNA as the transformingprinciple1. Experimented with R bacteria and extractmade from S bacteria2. Allowed them to observe transformation ofR bacteria3. Developed process topurify their extract1

a. Performed series of tests to find out iftransforming principle was DNA or proteinb. Performedchemical tests thatshowed no proteinswere present.c. Test revealed thatDNA was present4. Performed tests with Enzymesa. Added enzymes to break down proteinstransformation still occurred.b. Added enzymes to break down RNAtransformation still occurred.c. Added enzymes to breakdown DNA- transformationfailed to occur.C. Hershey and Chase confirm that DNA is thegenetic material1. Alfred Hershey and Martha Chase providedconclusive evidence that DNA was thegenetic material in 19522. Studied viruses that infect bacteria(bacteriophage)d. Concluded DNA wastransforming factora. Bacteriophage is simple- protein coatsurrounding DNA core1). Proteins contain sulfur buy very littlephosphorus2). DNA contains phosphorus and verylittle sulfurb. Experiment No.1- Bacteria infected with phageswith radioactive sulfur atoms- no radioactivityinside bacteriac. Experiment No.2- Bacteria infected with phageswith radioactive phosphorus atomsradioactivity found inside bacteriad. Concluded phagesDNA had entered bacteriabut proteins had not.Genetic material mustbe DNAII. Structure of DNA (8.2)A. DNA is composed of four types ofnucleotides1. DNA is longpolymer composedof monomers callednucleotides.2

a. Each nucleotide has three parts1). Phosphate group2). Ring-shaped sugar called deoxyribose3). Nitrogen-containing baseb. Scientists first believed that DNA was made ofequal parts of four different nucleotides (same in allorganismsB. Watson and Crick developed accurate model ofDNA’s three-dimensional structure1. Used previous work of other scientists andhypothesized that DNA might also be ahelix2. In 1950 Erwin Chargaff changed thinking byanalyzing DNA of several different organismsc. Found amount of adenine equals thymine andamount of cytosine equals amount of guanine.a. Found same four bases of DNA in allorganismsA T and C G (called Chargaff’s rules)b. Proportions of 4 bases were different inorganismsa. Rosalind Franklin and Maurice Wilkins used xray crystallography and suggested DNA helicalshapeb. Work of Hershey, Chase, Chargaff, and LinusPauling2. In 1953 Watson and Crick published their DNAmodel in a paper in the journal Naturea. DNA was double helixb. Strands arecomplementary (they fittogether and are theopposites of each otherpairing of bases accordingto Chargaff’s rules3

3. Nucleotides always pair in the same waya. Backbone formed by covalent bonds thatconnect sugar of one nucleotide to phosphateof anotherb. Two sides heldtogether by weakhydrogen bondsbetween basesc. Base pairingrules- A with T andC with G2. Free-floating nucleotides pair up one-by-oneforming complementary strands to templateIII. DNA Replication (8.3)A. Replication copies the genetic information1. Replication createsexact copies of itselfduring the cell cycle2. Replication assuresevery cell has completeset of identical geneticinformation3. Two identical molecules of DNA formedB. Proteins (enzymes) carry out the process ofreplication1. Enzymes begin to unzip double helix(DNA polymerases)a. Hydrogen bonds are brokenb. Molecule separates exposing basesC. Replication is fast and accurate1. Process takes just a few hours2. DNA replication starts at many points ineukaryotic chromosomes.3. DNA polymerases can find and correct errors.4

GTCTTAACACAGACTCT1. First the DNA must unzip:Enzymes split apart the base pairsand unwind the ATTGTGT2. Bases pair up: Free nucleotides inthe cell find their complementarybases along the original strand.5

TATAATGAAGCTGTAACACAATTGTGTCTTAACACAGATTGTGTCT3. Backbone Bonds: The sugarphosphate backbone is assembled tocomplete the DNA strandTAACACAGAIV. Transcription (8.4)A. RNA carries DNA’s instructionATTGTGTCT1. Francis Crick defined the centraldogma of molecular biologya. Replication copies DNATAATATCGATCGATGCATThe DNA is now duplicated:The cell can now divide into twodaughter cells.2. In prokaryotic cells processes take place incytoplasm3. In eukaryotic cells processes are separateda. Replication and Transcription in nucleusb. Translation occurs in cytoplasmb. Transcription converts DNAmessage into intermediatemolecule, called RNAc. Translation interprets anRNA message into string ofamino acids, calledpolypeptide (protein)6

4. RNA acts as messenger between nucleus andprotein synthesis in cytoplasm5. RNA differs from DNA in three significant waysa. Sugar in RNA is ribose not deoxyriboseb. RNA has the base uracil in place ofthymineB. Transcription makes three types of RNA1. Transcription copies sequence of DNA(one gene) and is catalyzed by RNApolymerasesa. DNA begins to unwind at specific site(gene)b. Using one strand of DNA, complementarystrand of RNA is producedc. RNA strand detaches and DNA reconnects3. The transcription process is similar to replicationV. Translation (8.5)A. Amino acids are coded by mRNA basesequences1. Translation converts mRNAmessages into polypeptides2. A codon is a sequence of threenucleotides that codes for an aminoacid.c. RNA is single stranded not double2. Transcription produces 3 kinds of RNAa. Messenger RNA (mRNA)- code fortranslationb. Ribosomal RNA (rRNA)- forms part ofribosomec. Transfer RNA (tRNA)- brings amino acidsfrom the cytoplasm to a ribosome to helpmake growing proteina. Both occur in nucleusb. Both involve unwinding of DNAc. Both involve complementary base pairing7

a. RNA could code 64 different combinationsb. Plenty to cover the 20 amino acids used to buildproteins in human body and most other organisms3. This code is universal- same in almost allorganismsa. Suggestscommon ancestorb. Means scientistcan insert gene fromone organism intoanother to makefunctional proteinc. Many amino acids coded by more than onecodond. Also special codons1). Start codon- signals start of translation2). Stop codon- signals end of amino acidchainB. Amino acids are linked to become a protein1. Two important “tools” needed to translate acodon into an amino acida. Ribosome- site of protein synthesis8

b. tRNA- carries free-floating amino acids fromcytoplasm to ribosome1). tRNA attaches to specific amino acid2). Has “3-letter” anticodon that recognizesa specific condon2. Translation occurs in cytoplasm of cella. mRNA binds to ribosomec. Exposed codon attracts complementary tRNAbearing an amino acidb. Ribosome pulls mRNA strand through onecodon at a timeanticodoncodond. Amino acids bond together and tRNA moleculeleaves to find another amino acide. Ribosome moves down mRNA attaching moreamino acids until reaches stop codon.Protein moleculeVI. Gene Expression and Regulation (8.6)A. Your cells can control when gene is “turnedon or off”B. Different in prokaryotic and eukaryotic cellsC. Because cells are specialized inmulticellular organisms, only certain genesare expressed in each type of cell.stop codon9

VII. Mutations (8.7)B. Gene MutationsA. Some mutations affect a single gene,while others affect an entire chromosome1. Mutation- a change in an organism’sDNA2. Mutations that affect asingle gene usually happenduring replication3. Mutations that affectgroup of genes orchromosome happenduring meiosis3. Chromosomal mutationsa. Gene duplication-exchange of DNAsegments through crossing over duringmeiosisb. Gene translocation- results from theexchange of DNA segments betweennonhomologous chromosomes1. Point mutation- onenucleotide is substitutedfor another2. Frameshift mutation- involves insertion ordeletion of a nucleotide in DNA sequenceResult of simplepoint mutationC. Mutations may or may not affect phenotype1. Impact on phenotypea. Chromosomal mutations affectmany genes and have big affecton the organismb. Some gene mutations change phenotype.1. A mutation may cause a premature stopcodon.2. A mutation may change protein shapeor the active site3. A mutation may change gene regulation10

c. Some gene mutations do not affect phenotype1. A mutation may be silent2. A mutation may occur in a noncodingregion3. A mutation may not affect protein foldingor the active site.2. Mutations in body cells do not affect offspring.3. Mutations in sex cells can be harmful orbeneficial to offspring4. Natural selectionoften removes mutantalleles from a populationwhen they are lessadaptive.D. Mutations can be caused by several factors1. Replication errors cancause mutations2. Mutagens, such as UVray and chemicals, cancause mutations3. Some cancer drugsuse mutagenicproperties to kill cancercells.11

1 UNIT 3 Chapter 12 From DNA to Proteins Chapter 12: From DNA to Proteins I. Identifying DNA as the Genetic Material (8.1) A. Griffith finds a “transforming principle” 1. Griffith experimented with the bacteria that cause pneumonia. Pneumococcus bac