Molecular Characterization Of Viroid Associated With Tapping Panel .
RESEARCH COMMUNICATIONS7. Feng, Q. L. et al., Spruce budworm (Choristoneura fumiferana)juvenile hormone esterase: hormonal regulation, developmentalexpression and cDNA cloning. Mol. Cell. Endocrinol., 1999, 148,95–108.8. Vermunt, A. M., Koopmanschap, A. B., Vlak, J. M. and de Kort,C. A., Expression of the juvenile hormone esterase gene in theColorado potato beetle, Leptinotarsa decemlineata: photoperiodicand juvenile hormone analog response. J. Insect Physiol., 1999,45, 135–142.9. Kethidi, D. R., Xi, Z. and Palli, S. R., Developmental and hormonal regulation of juvenile hormone esterase gene in Drosophilamelanogaster. J. Insect. Physiol., 2005, 51, 393–400.10. Kaminura, M., Takahashi, M., Kikuchi, K., Reza, A. M. S. andKiuchi, M., Tissue-specific regulation of juvenile hormoneesterase gene expression by 20-hydroxyecydysone and juvenilehormone in Bombyx mori. Arch. Insect. Biochem. Physiol., 2007,65, 143–151.11. Bowers, W. S., Juvenile hormone: activity of aromatic terpenoidsethers. Science, 1969, 164, 323–325.12. Pereira, J. and Gurudutt, K. N., Growth inhibition of Muscadomestica L. and Culex quinquefasciatus (Say) by (levo)-3epicaryoptin isolated from leaves of Clerodendrum inerme(Gaertn) (Verbenaceae). J. Chem. Ecol., 1990, 16, 2297–2306.13. Patil, P. B., Holihosur, S. N. and Kallapur, V. L., Efficacy of natural product, Clerodendrum inerme against mosquito vector Aedesaegypti. Curr. Sci., 2006, 90(8), 1064–1066.14. Hammock, B. D. and Roe, R. M., Analysis of juvenile hormoneesterase activity. In Methods in Enzymology (eds Law, J. H. andRilling, H. C.), Academic Press, Orlando, FL, 1985, pp. 487–494.15. Lowry, O. H., Rosebrough, J., Farr, A. L. and Randall, R. J., Protein measurement with the Folin phenol reagent. J. Biol. Chem.,1951, 193, 265–275.16. Linderman, R. J., Tshering, T., Venkatesh, K., Goodlett, D. R.,Dauterman, W. C. and Roe, R. M., Organophosphorus inhibitorsof insect juvenile hormone esterase. Pestic. Biochem. Physiol.,1991, 39, 57–73.17. Roe, R. M. et al., Developmental role of juvenile hormone metabolism in Lepidoptera. Am. Zool., 1993, 33, 375–383.18. Kallapur, V. L., Majumder, C. and Roe, R. M., In vivo and in vitrotissue specific metabolism of juvenile hormone during the laststadium of the cabbage looper, Trichoplusia ni. J. Insect Physiol.,1996, 42, 181–190.19. Bollenbacher, W. E., Vedeckis, W. V. and Gilbert, L. I., Ecdysonetiters and prothoracic gland activity during larval–pupal development of Manduca sexta. Dev. Biol., 1975, 44, 46–53.20. Fain, M. J. and Riddiford, L. M., Juvenile hormone titers in thehemolymph during late larval development of tobacco hornwormManduca sexta. Biol. Bull. Mar. Biol Lab., Woods Hole, 1975, 49,506–521.21. Nijhout, H. F., The role of ecdysone in pupation of Manducasexta. J. Insect Physiol., 1976, 22, 453–463.22. Dominick, O. S. and Truman, J. W., The physiology of wanderingbehaviour in Manduca sexta. II. The endocrine control of wandering. J. Exp. Biol., 1985, 17, 45–68.23. Venkatesh, K., Crawford, C. L. and Roe, R. M., Characterizationand the developmental role of plasma juvenile hormone esterase inthe adult cabbage looper, Trichoplusia ni. Insect Biochem., 1987,18, 53–61.ACKNOWLEDGEMENTS. We thank the Head and colleagues at theDepartment of Zoology, Karnatak University, Dharwad, for providinglaboratory facilities and Prof. R. Michael Roe, North Cardina StateUniversity, Raligh, NC, USA for providing radio-labelled JH and itsmetabolites used in the present work.Received 15 January 2014; revised accepted 13 February 20151520Molecular characterization of viroidassociated with tapping panel drynesssyndrome of Hevea brasiliensis fromIndiaAjay Kumar1,2 , D. M. Pandey1 ,Thomson Abraham3 , Jacob Mathew3,P. Jyothsna2 , Padma Ramachandran2 andV. G. Malathi2,*1Birla Institute of Technology, Deemed University, Mesra,Ranchi 835 215, India2Advanced Centre for Plant Virology, Division of Plant Pathology,Indian Agricultural Research Institute, New Delhi 110 012, India3Rubber Research Institute of India, Kottayam 686 009, IndiaTapping panel dryness (TPD) disease is the most economically important malady affecting the quality andquantity of yield of rubber latex. The etiological agentof the disease has not yet been characterized. In thepresent communication, we report the association of aviroid belonging to potato spindle tuber viroid group(PSTVd). The isolates cloned from TPD-affected rubber samples and tomato leaves infected by the extractfrom TPD-affected rubber showed more than 95%identity with PSTVd.Keywords: Rubber latex, tapping panel dryness disease,tomato leaves, viroids.VIROIDS are unique plant pathogens consisting of lowmolecular weight (LMW), non-encapsidated, autonomously replicating single-stranded RNA molecules ( 246to 425 nucleotides (nt)) without any functional openreading frames (ORFs) in their genome1. Ever since thefirst report of a viroid on potato2, about 32 viroid speciesand more than 340 viroid variants have been recorded. Inthe ‘Subviral RNA Database’ (http://subviral.med.uottawa.ca/), more than 1700 viroid sequences are available. They are the etiologic agents of diverse diseases affecting food, industrial and ornamental herbaceous andlignaceous plants. Viroid-induced symptoms range fromnecrosis to less severe developmental disorders, includingleaf chlorosis, necrosis, stunting, flowering alterations,and fruit and seed deformations. They are more prevalentin vegetatively propagated plants and in high-yieldingclones and varieties of plants developed.Potato spindle tuber viroid (PSTVd) belonging tothe family Pospiviroidae, has a wide host range and hasbeen reported from a wide variety of ornamental andhorticultural crops; to name a few, capsicum3, potato4,5,gooseberry6–8, Brugmansia spp9, Solanum jasminoides9,petunia10, tomato11, cestrum 7 and dahlia12. Avocado isby far the only tree species where PSTVd has been*For correspondence. (e-mail: vgmalathi@rediffmail.com)CURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015
RESEARCH COMMUNICATIONSrecorded13. Different variants of PSTVd range in sizefrom 359 to 370 nt with a well-conserved central domain.In India, occurrence of potato spindle tuber disease inpotato was reported in 1989 (ref. 14) and its viroid-likenature was confirmed later 15. The viroid causes typicalnecrotic lesions on leaves, stunting of plants and spindleshaped potato tubers. It is easily sap and graft transmittedto both potato and tomato.Tapping panel dryness (TPD) syndrome of rubber tree(Hevea brasiliensis) is widespread in all rubber-growingareas and is a matter of serious concern to rubber industry. It was first observed in Malaysia, affecting mostlyhigh-yielding clones of rubber 16. The disease derives itsname from the effect it causes on the rubber tree, namelyreduction in latex yield leading to partial and eventuallytotal dryness of the tapping panel. One of the causes thathave impeded progress in the management of TPD is thefact that the syndrome becomes evident, about six toseven years after transplanting, only when the trees reachmaturity for tapping. Many evidences had been put forward to show that the syndrome may be of abiotic nature,particularly due to physiological changes or nutritionaldeficiency17,18. However, involvement of different bioticagents with the syndrome has also been reported fromtime to time, viz. a virus19, a rickkettsia-like organism 20, aphytoplasma21 and a viroid22,23.Association of a viroid RNA with the TPD syndromeof rubber was first reported by Ramachandran et al.22 onthe basis return polyacrylamide gel electrophoresis (RPAGE), and RT-PCR using primers specific to PSTVd.But its sequences and relationship with other viroids werenot reported. Using R-PAGE24, LMW RNA has beendetected in leaf, bark and root of TPD-affected trees ofdifferent rubber clones grown in different locations, inseedlings as well as in bud grafted plants23. The infectious nature of the isolated LMW RNA from TPDaffected rubber plants was shown on healthy tomato seedlings cv. Pusa Ruby by sap inoculation. The LMW RNAwas reisolated from symptomatic tomato leaves whichreinfected healthy tomato seedlings, thus proving thebiotic etiology of TPD23.The present study reports cloning, sequencing andidentification of the LMW RNA associated with TPDaffected rubber trees as well as tomato inoculated withLMW RNA from rubber that showed symptoms ofepinasty and curling. A diagnostic probe for quick detection of TPD has also been developed and validated withfield samples of rubber.Leaf and bark samples of all the clones of rubber usedin the present study were collected from rubber treesgrowing in the Rubber Research Institute of India (RRII)farms at Kottayam, Kerala, India. The samples wereimmediately frozen and the nucleic acid was extractedfrom 2–5 g of tissue using the protocol described byKumar et al.23. The total nucleic acid (TNA) precipitatedby this method yields unsheared LMW RNA, which isCURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015further purified using RNeasy plant minikit (Qiagen,USA) following the manufacturers’ protocol. The purified RNA thus obtained was used to inoculate healthytomato plants. Nucleic acid extraction was also performed with leaves of healthy asymptomatic plants ofrubber clone RRII 105.The nucleic acid prepared from TPD-affected rubberplants was inoculated on tomato. The LMV RNA wasextracted 21 days post-inoculation from healthy uninoculated and inoculated symptomatic tomato plants, asdescribed earlier23.A total of 27 samples from TPD-affected rubber plantswere analysed along with eight samples from asymptomatic rubber tree and two samples of tomato plants,inoculated with TNA from healthy and TPD-affectedrubber trees, and with uninoculated tomato plants servingas control.The total RNA thus isolated from different samplesserved as a template for cDNA synthesis using Qiagenomniscript RT kit (Qiagen, USA). The first strand cDNAwas synthesized in a total reaction volume of 25 l (10 lof total RNA, 2 l dNTP mix (40 mM), 4 l 5 firststrand cDNA buffer, 1 l of DEPC-treated sterile distilledwater, 1 l RNase inhibitor (30 U l), 200 pmol/ l ofeach reverse primers, and 1 l of M-MLV (200 U l)reverse transcriptase) and the reaction mix was incubatedat 42 C for 60 min and then at 72 C for 5 min (forenzyme inactivation). The cDNA was amplified by PCR(50 l reaction volume containing 5 l of cDNA, 5 l(10 ) PCR reaction buffer, 4 l (2.5 mM) dNTP mix, 4 lMgCl2 (25 mM), 200 pmol/ l each of forward and reverse primers, 1 l (2.5 units) of Taq DNA polymeraseand 29 l RNase free water) following the phenol : isoamyl alcohol extraction protocol25. Two differentsets of primers specific to potato spindle tuber viroidwere designed from the consensus sequences in the central conserved region and used. They are: set I Abt C-F,CAACTGAAGCTCCCGAGAACCGCT (nt position273–296) Abt C-R, TTTCCACCGGGTAGTAGCCGAAGCGAC (nt position 272–246); set II PSTVF CCGGTGGAAACAACTGAAGCTCCCGAGAAC (nt position263–292) PSTVR GTAGTAGCCGAAGCGACAGCGCAAAGGGGG (nt position 262–233). The PCR amplicons were expected to be of 350–370 bp length. PCRproducts were purified from the gel using a Gel Extraction Kit (Qiagen, USA). The double-stranded cDNA wascloned in pGEM-T Easy vector (Promega). The Escherichia coli strain DH5 cells were transformed withthe recombinant plasmids and selected clones weresequenced at the facility at Delhi University, South Campus, New Delhi, India. Sequence data were edited andaligned according to the convention followed in viroidgenome editing.The viroid sequences obtained in the present study areavailable in NCBI GenBank database under accession nosHM107843 to HM107848. To understand the relationships1521
RESEARCH COMMUNICATIONSwith other viroids, the sequences were compared withother viroid sequences obtained from NCBI database inmultiple sequences alignments done using the CLUSTALX program26. A phylogenetic tree was constructed usingMEGA 4.0 bootstrapping from 1000 replicates. Multiplealignment of nucleotide sequences of the viroids in thepresent study was done with PSTVd sequence availablein database in Bioedit sequence alignment editor version5.09, to know the sequence identity between them. Fornucleic acid spot hybridization (NASH) tests, plant extract (PE) and nucleic acid extract (NAE) were preparedindividually and dotted onto nylon membrane. Hybridization was carried out using 32 P-labelled cDNA probe asdescribed previously27. The RNA extract from TPDinfected rubber samples (2, 4/4, 19, 44, 50) was subjectedto real-time PCR analysis. The RNA extracted fromhealthy rubber samples (24H) served as negative control,while plasmid DNA of the viriod clone (PSTVd-RubberKER1) served as positive control. The qRT-PCR reactionmixture (20 l) consisted of 2 SYBR Green Master Mix(Roche Diagnostics GmbH, Penzberg, Germany). 0.2 Mprimers and 500 ng of the template. The PCR conditionswere kept as 95 C for 10 min, followed by 40 cycles of10 sec at 95 C, 30 sec at 58 C and 30 sec at 72 C foramplification. The mixture was then subjected to qRTPCR using LightCyclerR 480 Real-Time PCR System(Roche Diagnostic GmbH, Germany) coupled with theDNA-binding flouresecent dye SYBR Green I. All amplified products were analysed by recording fluorescence.The threshold cycle (Ct) at which significant increase influorescence occurs was calculated using software version LCS480 1.5.0.39 provided with the LightCycler R480. Melting curve analyses were performed to verify thespecific product formation.In this study, a total of 27 samples of rubber trees wereanalysed, most of which showed symptoms of panel dryness as they were in the different stages of tapping.Among the 27 samples analysed, LMW RNA weredetected in 21 samples by R-PAGE, reconfirming theapplication of electrophoresis under denaturing conditionto facilitate efficient detection. The extracted LMW RNAwas used as template for cDNA synthesis and PCRamplicon of 400 bp was observed in 15 out of 22 TPDaffected samples tested with both the sets of primers.No such amplicon was observed with nucleic acidextract from healthy asymptomatic rubber seedlings(Figure 1). The details of PCR results are provided inTable 1, from which it is clear that PCR amplicons wereobserved in 56% of symptomatic plants analysed, irrespective of the stage of the tapping.Inoculation of LMW RNA extract onto tomato seedlingled to symptom expression in tomato seedlings about 21days post-inoculation, as reported earlier 23. The typicalsymptoms were epinasty, mild drooping of top leaves,and overall chlorotic and stunted appearance of plants.The nucleic acid extract from such symptomatic tomato1522leaves gave rise to 400 bp amplicon with both sets ofprimers. No such amplicons were obtained with nucleicacid extract from uninoculated healthy tomato seedlings.The PCR products from eight samples (chosen randomly marked * in Table 1) were cloned in pGEM-T easyvector. In all the clones 359–400 bp fragments werereleased when restricted with EcoRI, indicating the insertion of anticipated viroid-like fragment. The insert inFigure 1. Agarose gel electrophoresis of RT-PCR amplicons obtainedwith RNA extract from (a) samples tomato and (b) rubber. Lane M,Molecular weight marker (1 M); lanes 1–7, RNA extract from tomatoplants inoculated with extract from the following TPD-affected rubbersamples: lane 1, 2, TPD; lane 2, 4/4TPD; lane 3, 95H; lane 4, no sample; lane 5, 2TPD; lane 6, 95H; lane 7, 4/4TPD. b, Lane M, 100 bpmarker; lanes 1–3, amplicon from TPD-affected rubber samples; lane 1,6/15 and lane 2, 6/15 and lane 3, 95.Table 1.Detection of LMW RNA viroid in TPD-affected rubberplants by R-PAGE and PCRRubber sample ID*4/4 TPD24 H62 TPD120 TPD*6/15 TPD*2 TPD11 H36 H116 TPD*95 TPD98 H103 H*50*44*190915*19R-PAGEBLLBLBLBLBLBLBLBLBLLLLLLLLL ve ve– ve– ve ve ve ve ve ve ve ve ve ve ve– ve– ve ve ve ve– ve– ve ve ve ve ve ve vePCR ve– ve ve (400 bp) ve (400 bp) ve (400ve (400ve (400ve (400ve (400bp)bp)bp)bp)bp)– ve ve (350 bp) ve (400 bp)–ve ve (400ve (400ve (400ve (400ve (400ve (400bp)bp)bp)bp)bp)bp)*Samples which were cloned. L, Leaf samples; B, bark samples.CURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015
RESEARCH COMMUNICATIONSFigure 2. Multiple nucleotide sequence alignment of PSTVd isolates. PSTVd-Rubber-KER-1-8 isolates compared with those of PSTVd variantsfrom other host species and countries.selected clones from eight samples was sequenced. Thecloned fragment from eight samples (Table 2) wasapproximately 359–361 nt in length. Each sequence wasindividually analysed in BLAST to identify the sequenceCURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015with which maximum identity is exhibited. All the clonesshowed more than 95% sequence identity with differentPSTVd isolates. Maximum identity was observed withPSTVd isolates from USA, M16826 and AY9371791523
RESEARCH COMMUNICATIONSinfecting potato. On the basis of nearly 100% identitywith PSTVd isolates M16826 and AY937179, the viroidsequences characterized from rubber samples are considered as variants of PSTVd and the name proposed isPSTVd-Rubber-KER-1–8, to denote its origin from therubber tree followed by clone id KER-1-8 indicating thegeographic origin from Kerala.The multiple alignment of nucleotide sequences of rubber isolates with PSTVd from other plant species is givenin Figure 2. The viroid sequence from rubber varied inlength from 359 to 361 nt. The viroid sequences exhibited99–100% identity between themselves. The identity seenbetween rubber isolates and other PSTVd isolates wasalso high (Table 3). It was 100% with PSTVd M16826and AY937179 from potato originating from USA, thelowest being 91.9% recorded with PSTVd isolate fromTable 2.Rubbersample ID19 Abt44 Abt95 PSTV6/15 PSTV2 PSTV4/4 PSTV50 Abt6/15 AbtDetails of PSTVd-rubber viroid characterized in the presentstudyClone R1KER2KER3KER4KER5KER6KER7KER8Length ofgenome (bp)GenBankaccession 5HM107846HM107847HM107848Solanum muricatum, Slovenia and 93.6% from Capsicumannuum, New Zealand.The region which is varying characteristically in rubberisolates compared to other PSTVd isolates is a segmentfrom nt 323 to 329; there is deletion of nucleotides in allthe rubber isolates at 328, 327 and 325 and substitution of‘A’ instead of ‘C’ at position 323. There is an insertion of‘G’ at position 61 in PSTVd-Rubber-KER8 similar to isolates from dahlia, tomato and capsicum. Whether variation in this region (which falls in the pathogenicitydomain) will contribute to any specific pathogenicity criteria needs to be studied. Among the rubber isolates, theclone ID KER-6 showed insertion of seven nucleotides;267 to 274 nt. One or two substitutions are also seen inPSTVd rubber isolates, perhaps contributing to somevariability.In a phylogenetic tree constructed on the basis of alignment of full-length sequence, the rubber isolates PSTVdRubber-KER-3, PSTVd-Rubber-KER-4, PSTVd-RubberKER-7 and PSTVd-Rubber-KER-6 clustered together asone group. These isolates along with PSTVd-RubberKER-1, KER-2, KER-5 formed a part of the major clustercomprising PSTVd potato isolates from Poland and Iran.However, PSTVd-KER-8 isolate occupied a branch separate from other rubber isolates (Figure 3).Table 3.Nucleotide identity between PSTVd-Rubber-KER1 isolateand other PSTVd isolatesPSTVd-RubberKER1 (%)ViroidFigure 3. Phylogenetic relationship between viroid populations. Dendrogram constructed using the neighbour joining method with 1000replications of bootstrap based on alignment of full-length nucleotidesequences. Alignments were produced with Clustal W MEGA 5.Numerals at the nodes refer to the number of times the branching wassupported. The sequences of PSTVd isolates included in the analysisare given with their respective accession 492082 PSTVd Potato, PolandM16826 PSTVdAY937179 PSTVdHQ454934 PSTVd Solanum jasminoides, SloveniaY08852 PSTVd potato, PolandDQ308560 PSTVd potato, IranGU481090 PSTVd Brugmansia sp., GreeceAB623143 PSTVd dahlia, JapanAJ634596 PSTVd Nicotiana bethamiana, GermanyAJ583449 PSTVd tomato, UKAF369530 PSTVd tomato, New ZealandEU862231 PSTVd Cape Gooseberry, Trukey andGermanyAY532803 PSTVd Capsicum annum, New ZealandGU481091 PSTVd Solanum jasminoides, GreeceHQ454936 PSTVd Petunia, SloveniaHQ639700 PSTVd Potato, IndiaJQ889840 PSTVd Potato, UKHQ454932 PSTVd Solanum muricatum, SloveniaHQ452399 PSTVd Cestrum aurantiacum, .991.9CURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015
RESEARCH COMMUNICATIONSRadiolabelled probe prepared from cloned DNA ofTPD-affected rubber was used in nucleic acid spothybridization test to detect the presence of viroid in fieldsamples of rubber. The autoradiogram (Figure 4) showedthe presence of viroid in TPD-affected samples in 1 : 1and 1 : 10 dilution. Results showed that the radiolabelledprobe could detect the presence of viroid in TPD-affectedsamples both in plant and nucleic acid extracts from rubber and TPD inoculated tomato. However, the intensity ofthe signal was low in some samples (Figure 4, lanes 5, 6,8 and 9), which is attributed to the difference in the concentration of the viriods.Melting profile analysis performed at the completion ofamplification revealed Tm peaks of 88.29 1 C for theplasmid DNA and for samples from TPD-affected rubbersamples. The profile was similar in both confirming thepresence of the same LMW RNA in all the samples. Thehealthy control did not show any increase in fluorescence,indicating the absence of non-specific amplification. Thehigh Ct value varied from 27.79 to 29.30, which clearlyindicated low concentration of viroid in the samplestested (Figure 5).Reports on the biotic etiology of TPD of rubber arerather scanty. A recent report from our laboratory23 hasdemonstrated the constant association of a LMW RNAwith samples of TPD-affected rubber tissue (leaf, barkand root) and has further shown it to be infectious oninoculated young seedlings of tomato. The LMW RNAwas reisolated from inoculated symptomatic tomato leaves,which further infected healthy tomato. However, its infectivity on rubber seedlings remains to be demonstrated.The present report confirms that the LMW RNA isolated is a viroid, a distinct variant of the most widespreadPSTVd. Although in our study we found tomato to be anexperimental host of the rubber isolate, it is quite different from the naturally occurring PSTVd isolate infectingFigure 4. Results of nucleic acid spot hybridization test-32 P-labelledcDNA probe from rubber viroid clone was used to detect viroid in fieldsamples of rubber L-R healthy (H) (24H), plasmid control positive control 4/4 TPD plasmid clone 1, 19 TPD; 2, 44 TPD; 3, 6/15 TPD (leaf);4, 6/15 TPD (bark); 5, 95 TPD; 6, 9 TPD; 7, 2 TPD (leaf); 8, 50 TPD;9, 4/4 TPD; 10, 2 TPD (bark); 11, 6/15 TPD (tomato inoculated) and12, 2 TPD (tomato inoculated).CURRENT SCIENCE, VOL. 108, NO. 8, 25 APRIL 2015tomato (AJ 583449 from UK). The variations that havebeen observed in terms of addition and deletion ofnucleotides are all either in the pathogenicity or the variable domains of the viroid, which can perhaps explain thealtered pathogenicity of PSTVd to infect totally a newhost causing the very characteristic symptoms on thishost rubber. In recent years, PSTVd has been recordedfrom a wide variety of ornamental and horticulturalplants28. Infection of tree species by PSTVd beenrecorded in avocado29. Incidentally, tomato and avocadohave been reported as new emerging hosts of PSTVd inrecent times30. Our results of multiple alignment ofsequences of the clones of rubber with those of PSTVdon other hosts revealed only minor variations pertainingto one or more nucleotides. It is well known that a smallvariation in the case of viroid is sufficient to change thepathogenicity, virulence and host preference31,32. In thecase of PSTVd, it was observed that even a single nucleotide substitution (C–U in position 259) changed thePSTVd from a non-infectious to an infectious RNA capable of infecting tobacco33. Similar variations have beenreported for mild and severe variants of citrus exocortisviroid (CEVd)34, and for CEVd variants infecting citrusand tomato in India 35. In the present study, it was foundthat the rubber isolates show 97.5% identity with PSTVdFigure 5. Amplification plot (a) and melting profile (b) generated byreal-time PCR reactions performed with cDNA from TPD-affected testsamples (2, 4/4, 19, 44, 50). RNA extract from healthy rubber samplesserved as negative control. The reaction was performed with 50 ng ofplasmid DNA of the clone PSTVd-Rubber-KER1 as positive control.1525
RESEARCH COMMUNICATIONSreported on potato from India (seq. HQ639700). Apparently, the minor sequence variation coupled with hostpreference and other geographical conditions in which thetwo hosts are growing has possibly influenced pathogenicity of the viroid. At present, it is difficult to understand how PSTVd can be associated with a uniquesymptom that specifically impairs the function of laticiferous cells. However, symptoms of bark cracking, bulging and other abnormalities observed with TPD-affectedplants are known to be associated with viroid infection intree species36. Higher frequency of occurrence with highyielding varieties/clones and vegetative propagation ofthe crop and seed transmission are some attributes ofviroid diseases which rubber exhibits.Our study thus confirms association of a PSTVd variant with the TPD syndrome of rubber, a century-old problem worldwide. It is proposed to designate the causalagent of TPD of rubber as PSTVd-Rubber-KER variant.That the cloned DNA could be used as a probe was alsoshown when PSTVd as a probe in dot-blot tests reactedspecifically to nucleic acid extracts from TPD-affectedrubber, but not from healthy trees. In the present studyalso, the cloned DNA was successfully used in spot hybridization for viroid detection from rubber samples. Thiswill certainly prove to be a useful diagnostic tool for detection of the pathogen in planting material and help theorchardist in management of the problem. The study merits further investigations to prove the pathogenity of theisolated viroid on rubber in order to conclusively determine if the entire panel dryness symptom is causedby PSTVd alone, or there is involvement of otherviroids/factors.1. Flores, R., Serio, F. Di. and Hernandez, C., Viroids: the noncodinggenomes. Semin. Virol., 1997, 8, 65–77.2. Diener, T. O., Potato spindle tuber ‘virus’ IV. A replicating, lowmolecular weight RNA. Virology, 1971, 45, 411–428.3. Lebas, B. S., Clover, G. R., Ochoa-Corona, F. M., Elliott, D. R.,Tang, Z. and Alexander, B. J., Distribution of potato spindle tuberviroid in New Zealand glasshouse crops of capsicum and tomato.Australas. Plant Pathol., 2005, 34, 129–133.4. Diener, T. O. and Raymer, W. B., Potato spindle tuber virus: aplant virus with properties of a free nucleic acid. Science, 1967,158, 378–381.5. Singh, R. P., Boucher, A. and Seabrook, J. E. A., Detection of themild strains of potato spindle tuber viroid from single true potatoseed by return electrophoresis. Phytopathology, 1988, 78, 663–667.6. Verhoeven, J. Th. J., Jansen, C. C. C., Botermans, M. and Roenhorst, J. W., Epidemiological evidence that vegetatively propagated, solanaceous plant species act as sources of Potato spindletuber viroid inoculum for tomato. Plant Pathol., 2009, 59, 3–12.7. Luigi, M., Luison, D., Tomassoli, L. and Faggioli, F., Naturalspread and molecular analysis of pospiviroids infecting ornamentals in Italy. J. Plant Pathol., 2011, 93, 491–495.8. Marn, M., Virscek, M. and Plesko, I. M., First report of potatospindle tuber viroid in cape gooseberry in Slovenia. Plant Dis.,2012, 96(1), 150.9. Malandraki, I., Papachristopoulou, M. and Vassilakos, N., Firstreport of potato spindle tuber viroid (PSTVd) in ornamental plantsin Greece. New Dis. Rep., 2010, 21, 9.152610. Mertelik, J. et al., First report of Potato spindle tuber viroid(PSTVd) in Brugmansia spp., Solanum jasminoides, Solanum muricatum and Petunia spp. in the Czech Republic. J. Plant Pathol.,2010, 59, 392.11. Mumford, R. A., Jarvis, B. and Skelton, A., The first report ofpotato spindle tuber viroid (PSTVd) in commercial tomatoes in theUK. Plant Pathol., 2010, 53, 242.12. Tsushima, T., Murakami, S., Ito, H., He, Y., Raj, A. P. C. andSano, T., Molecular characterization of Potato spindle tuber viroidin dahlia. J. Gen. Plant Pathol., 2011, 77, 253–256.13. Querci, M., Owens, R. A., Vargas, C. and Salazar, L. F., Detectionof potato spindle tuber viroid in avocado growing in Peru. PlantDis., 1995, 79, 196–202.14. Khurana, S. M. P., Singh, M. N., Garg, I. D. and Agarwal, H. P.,PSTV and viroid like infection in solanaceous plants in Shimlahills. In Indo-US Workshop on Viroid and Disease of UncertainEtiology, IARI, New Delhi, 15–18 November 1989.15. Owens, R. A., Khurana, S. M. P., Smith, D. R., Singh, M. N. andGarg, I. D., A new mild strain of potato spindle tuber viroidisolated from wild Solanum spp. in India. Plant Dis., 1992, 76,527–529.16. Sharples, S., Brown bast. In Diseases and Pests of the RubberTree, MacMillan, London, 1936, pp. 229–265.17. Pushpadas, M. V., Nair, K. K., Krishnakumari, M. and Karthikakuttyamma, M., Brown bast and nutrition. Rubber Board Bull.,1975, 1(12), 83.18. Sethuraj, M. R., Nair, N. U., George, M. J. and Mani, K. T.,Physiology of latex flow in Hevea brasiliensis as influenced by intensive tapping. J. Rubber Res. Inst., Sri Lanka, 1977, 54, 221–226.19. Peries, O. S. and Brohier, Y. E. M., A virus as causal agent ofbark cracking in Hevea brasiliensis. Nature, 1965, 205, 624–625.20. Zheng, G., Chen, M., Yung,
In Methods in Enzymology (eds Law, J. H. and Rilling, H. C.), Academic Press, Orlando, FL, 1985, pp. 487-494. . fied RNA thus obtained was used to inoculate healthy . genome editing. The viroid sequences obtained in the present study are
Molecular characterization is the description of an accession using molecular markers. Molecular makers are readily detectable sequence of DNA or proteins whose inheritance can be monitored. There are several methods that can be employed in molecular characterization ,which differ from each other in term of ease
Characterization: Characterization is the process by which the writer reveals the personality of a character. The personality is revealed through direct and indirect characterization. Direct characterization is what the protagonist says and does and what the narrator implies. Indirect characterization is what other characters say about the
The journal Molecular Biology covers a wide range of problems related to molecular, cell, and computational biology, including genomics, proteomics, bioinformatics, molecular virology and immunology, molecular development biology, and molecular evolution. Molecular Biology publishes reviews, mini-reviews, and experimental and theoretical works .
Jan 31, 2011 · the molecular geometries for each chemical species using VSEPR. Below the picture of each molecule write the name of the geometry (e. g. linear, trigonal planar, etc.). Although you do not need to name the molecular shape for molecules and ions with more than one "central atom", you should be able to indicate the molecular geometryFile Size: 890KBPage Count: 7Explore furtherLab # 13: Molecular Models Quiz- Answer Key - Mr Palermowww.mrpalermo.comAnswer key - CHEMISTRYsiprogram.weebly.comVirtual Molecular Model Kit - Vmols - CheMagicchemagic.orgMolecular Modeling 1 Chem Labchemlab.truman.eduHow to Use a Molecular Model for Learning . - Chemistry Hallchemistryhall.comRecommended to you b
Xiangrun's Molecular sieve Email:info@xradsorbent.com Tel:86-533-3037068 Website: www.aluminaadsorbents.com Molecular sieve Types 3A Molecular sieve 4A Molecular sieve 5A Molecular sieve 13X Molecular sieve PSA Molecular Sieve Activated zeolite powder 3A Activated zeolite powder 4A Activated zeolite powder 5A
characterization: direct characterization and indirect characterization. Direct Characterization If a writer tells you what a character is like the method is . Dr. Chang was the best dentist in the practice. He had a charming smile, a gentle manner, and a warm personality.
our characterization. Given this novel characterization, we can pro-duce models that predict optimization sequences that out-perform sequences predicted by models using other characterization tech-niques. We also experimented with other graph-based IRs for pro-gram characterization, and we present these results in Section 5.3.
the principles of English etymology, than as a general introduction to Germanic philology. The Exercises in translation will, it is believed, furnish all the drill necessary to enable the student to retain the forms and constructions given in the various chapters. The Selections for Reading relate to the history and literature of King Alfred’s day, and are sufficient to give the student a .
