Viral Evolution And Recombination - Göteborgs Universitet
Viral Evolution andRecombinationPeter Norbergpeter.norberg@gu.sePhylogenetic analysis Reconstruction ofevolutionary history Relationship Distance Common ancestors
Different representationsA B C DABABCDABCDCDABCDBootstrap-Construct several new sequence sets (1000 st.)-A new sequence set is generated by randomlypicking of columns from the original set-Apply the phylogenetic algorithm on all sets.-Make one consensus tree from all trees
BootstrappingA: AACTTAACCACGCTATCGATGCAATTATATAB: AATTTGACTGCGGTACCGATCCAATTATATAC: AATTTGACTGGGCTACCGATCCAATTATATAD: AACTTAACCGCGCTACTGATCGAATTATATAA: CACCB: TGCTC: TGCTD: CAGCAA196CD1CRecombinationBBB96A3C3DD
Recombination Speeds up evolution (up to 10,000 times) Accumulate beneficial mutations Expel deleterious mutationsRecombination and phylogenyXHCACADDEEHBIFGHBIFG
Recombination and phylogenyHXCADEHBIFGPhylogenetic networksHXCADEHBIFG
Methods for detection ofrecombinants-Detecting conflicting phylogenetic signals Phylogenetic networks (SplitsTree) Can be due to recombination or homoplasyMethods for detection ofrecombinants-Analyze conflicting phylogenetic signals,recombination vs homoplasy, and definebreakpoints Bootscan (SimPlot) Similarity plots (SimPlot) Statistical tests (phi-test) RDP, Geneconv, MaxChi, Chimaera, SisScan,3Sec, LARD, Topal, . (RDP)
Viral phylogeny and genetics Genetic diversity Evolutionary history Evolutionary mechanisms Genotype/phenotype association studies(Genetic markers responsible for specificsymptoms?)Herpes simplex virus type 1 and 2 oral (HSV-1) or genital (HSV-2) lesions. encephalitis, meningitis, keratitis, spread via direct contact Establish latency in sensorial ganglia 60-80% asymptomatic infections common 100 nm in diameter capsid Surrounded by a lipidenvelope several glycoproteins on thesurfacePhoto by Linda M. Stannard, University of Cape Town.
HSV-1 evolution sub-genomic phylogeny three distinct cladesUS7US8 recent recombination eventsNorberg et al J Virol 2004HSV-1 recombination analysisNorberg et al J Virol 2004
HSV-1 recombination analysis affecting whole clade “ancient” recombinationNorberg et al J Virol 2004 Frequency of recombinants? Screening based on one or fewloci possible? genetic linkage Complete genome anlaysis!Norberg Infect Genet Evol 2010
Complete Genome HSV-1 Analysis 12 complete genomes Phylogenetic network Clades still present? “Star phylogeny” Frequent recombination events Weak genetic linkage Diversity 0.4-1.7%Norberg, et al PLoS ONE 2011
HSV-2 evolution sub-genomic phylogeny strains from Sweden, Norway andTanzania two “straggling” clades frequent recombination events complete genome analysis?Norberg et al J Virol 2007HSV-2recombinationanalysisNorberg et al J Virol 2007
Varicella-Zoster virus (VZV) chicken pox (varicella), shingles (herpes zoster) neurological manifestations, pneumonia, keratitis, spread by aerosol 95%VZV evolution5 Complete genome analysis At least five distinct clades Consensus nomenclature23 Diversity 0.1-0.5% “Ancient” recombination events Few recombinants Simple screening14Norberg et al J Virol 2006, Peters et al J Virol 2006, Breuer et al J Gen Virol 2010
Time since divergence VZV:60,000 - 100,000 years HSV-1: 400,000 - 700,000 yearsRecombination Why so low frequency of VZV recombinants? Why only ancient and not recent recombinants? Likely to have the same ability to recombine VZV easily recombines in animal models Recent VZV “Intra clade” recombination
Recombination Geographic separation About to fade out Immigration VaccineThe future?
Summary herpesvirus evolution Each virus evolved to different clades Genetic variability:- HSV-1 : 3%- HSV-2 : 0,5%- VZV : 0,2% Recombinants common Recombination is a general mechanism in the evolution of human -herpesviruses– Most common for HSV-2, followed by HSV-1. Least common for VZV In combination with different genotypes, infinite numbers of different mosaic genomesmay arise Genotyping of complete HSV-1 genomes into clades irrelevant! Differences in geographic distribution (HSV-1 more mixed than VZV) May change due to migration and vaccination! The mosaic genetics of HSV-1 can be a plausible indicator on future evolutionarycharacteristics of VZV
Peter Norberg peter.norberg@gu.se Phylogenetic analysis Reconstruction of evolutionary history Relationship Distance . RDP, Geneconv, MaxChi, Chimaera, SisScan, 3Sec, LARD, Topal, . (RDP) Viral phylogeny and genetics Genetic diversity Evolutionary history Evolutionary mechanisms Genotype/phenotype association studies
Genes linked together on the same chromosome usually assort together. Linked genes may become separated through recombination. Part 2 Mapping Recombination data can be used to generate maps of relative locations of genes on chromosomes Part 3 Mitotic recombination Rarely, recombination occurs during meiosis.
HOLLIDAY INTERMEDIATES IN SITE-SPECIFIC RECOMBINATION reaction mixtures. Intermolecular recombination is en-hanced by the addition ofpolyethylene glycol (PEG). FLP protein catalyzes recombination with a relatively low turn- over number(13a). As stated above, the recombination site usedbythe FLP system, designated FRTfor FLPrecombinationtarget (46), consists of an 8-bp asymmetric spacer .
scan, Maxchi, Chimaera, SiScan, 3seq) [22] were used to detect evidence of recombination with default parame-ters (p value 0.05, Bonferroni corrected) and depict the distribution of recombination events, in different CoV alignments: 1. The following selection of viral strains (Genbank accession names) was used in order to find
viii Kit Contents and Storage Types of Kits This manual is supplied with the kits listed below. Product Catalog no. MultiSite Gateway Pro 2.0 Kit for 2-fragment recombination 12537-102 MultiSite Gateway Pro 3.0 Kit for 3-fragment recombination 12537-103 MultiSite Gateway Pro 4.0 Kit for 4-fragment recombination 12
Recent single-molecule studies of bacteriophage T4 recombination proteins revealed that, surprising-ly, the UvsY recombination mediator protein binds stronger to stretched dsDNA molecules than to stretched ssDNA. Here, we show that for relaxed DNA lattices, the opposite is true: UvsY exhibits
Structure, Function, and Evolution of Coronavirus Spike Proteins Fang Li . During virus entry, S1 binds to a receptor on the host cell surface for viral attachment, and S2 fuses the host and viral membranes, allowing viral genomes to enter host cells. Receptor binding and membrane fusion are the initial and critical steps in the coronavirus
tourist E-behaviours (Kaplan & Haenlein, 2010). Therefore, it is important to explore viral marketing on tourism and hospitality organizations. Despite the importance of viral marketing on the tourism and hospitality industry, there are few studies exploring the relationship between viral marketing and tourists' behaviour (Soteriades, 2011).
Viral Hepatitis C: Introduction “Viral hepatitis," refers to infections that affect the liver and are caused by viruses. It is a major public health issue in the United States and worldwide. Not only does viral hepatitis carry a high morbidity, but it also stresses medical resources and can have severe
