DNA Sequencing: The Past, The Present And The Future - UT Southwestern

9/12/16STARS Mini-Symposium 9/12/2016DNA Sequencing: The Past, the Presentand the FutureRalf Kittler, Ph.D.McDermott Center for Human Growth and NA sequencing is a biochemical method todetermine the sequence of the nucleotidebases that make up the DNA1. The Past – Sanger Sequencing2. The Present – Illumina Sequencing3. The Future – Single Molecule Sequencing1

9/12/16Part 1The pastSanger Sequencing(First-Generation Sequencing)The Discovery of the DNA Structure1953WATSON and CRICK describe the structure of DNA basedon the X-ray analyses of FRANKLIN and WILKINS“Photograph 51”Watson-Crick Model(Franklin R and Gosling R, 1953)(Watson J and Crick F, 1953)2

9/12/16DNA StructureGenetic information iscontained in the order ofthe bases (Sequence)DNA structure provides thebasis for replication andtranscription by using asingle strand as a template(Base pairing) 2013 Nature EducationDNA Polymerase1957KORNBERG discovers DNA polymerase as enzyme for DNAreplication(Molecular Biology: Principles and Practice, 2012)Complementary nucleotide is incorporated by forming a phosphoester bondwith the 3’OH of the deoxyribose of the preceding nucleotide (strand extension)3

9/12/16Molecular Cloning1970BERG, BOYER, and COHEN develop Molecular CloningRestric0onenzyme Ligasewww.mo0folio.comMolecular cloning allows isolation, amplification and manipulation ofspecific DNA fragmentsFirst-Generation Sequencing1977SANGER develops chain-termination sequencing (Sanger sequencing)GILBERT and MAXAM develop sequencing by base-specific chemicalfragmentationWalter GilbertFrederick Sangerhttps://www.nobelprize.org/nobel prizes/chemistry/laureates/1980/4

9/12/16Sanger Sequencing: Dideoxynucleotides (ddNTPs)Chain Termination by ddNTP Incorporation(Molecular Biology: Principles and Practice, 2012)For Sanger sequencing ratio of dNTP:ddNTP 100:1è Mixture of terminated strands is producedè The identity of the last incorporated base can be identified by gelelectrophoresis and radioactive, or fluorescent detection5

9/12/16Sanger Sequencing 1.0 (1977-1980s)Gel electrophoresisDetection ofradioactiveDNA strandsManual processhttp://www.atdbio.comSanger Sequencing 1.0 (1977-1980s)(Sanger et al., 1977, PNAS)6

9/12/16Fluorescent ddNTPsFluorophoreddATPddTTPddGTPddCTPSanger Sequencing 2.0 (1990s-present)Fluorescently labeledddNTPsGel electrophoresisDetection offluorescent productsTAutomated processhttp://www.atdbio.com7

9/12/16Sanger Sequencing at UT SouthwesternABI 3730xl DNA Analyzer (Capillary Sequencer)96 DNA samples with 700 nucleotide reads ( 70,000 bases) in 2.5 hoursSanger Sequencing at UT SouthwesternDetectedfluorescentDNA productsA single trace(electropherogram)CCACCCGCAGTTCGAAAAAGG Sequence8

First bacterial genome (Haemophilus influenzae) sequenced2001First draft of the human genome publishedPart 2The PresentIllumina Sequencing(Next-Generation Sequencing)9

9/12/16Impact of Next-Generation SequencingIllumina NextSeq Flow Cell400,000,000 DNA fragments X 300 nucleotides 120,000,000,000 nucleotides in 29 hours10

9/12/16Illumina Sequencing BenchmarksNextSeq 500The Human Genome Projectvs.1 Technician29 hours 4000120,000,000,000 nucleotidesHuman genome X 40 1000 Scientists13 years (1990-2003) 3,000,000,00024,000,000,000 nucleotidesHuman genome X 8Illumina Sequencing is ScalableHiSeq X Ten: Single device has 15X capacity of the NextSeq 500Cost for sequencing of a human genome (at 40X): 100011

9/12/16Next-Generation SequencingTechnological advances that enabled massively parallel sequencing:1. Miniaturization of clonal amplification of millions of individual DNAfragments on a solid supportIllumina sequencing: Bridge Polymerase Chain Reaction (PCR)2. Sequencing reaction chemistry that can be performed on clonallyamplified DNA fragments on a solid supportIllumina sequencing: Cyclic-reversible termination sequencingDNA Amplification: Polymerase Chain Reaction (PCR) 2014 Nature Education12

9/12/16Illumina Sequencing: Bridge PCRLibrary generationAttach DNA to surfaceBridge PCRIllumina, Inc.Illumina Sequencing: Bridge PCRDNA fragment after1st amplification stepClusters after multipleDenaturation andnext amplification step amplification cyclesIllumina, Inc.13

9/12/16Reversible Terminator NucleotidesSanger SequencingFluorophoreIllumina SequencingFluorophoreCleavableCleavable3’ blocking groupReversible terminator nucleotideIllumina Sequencing ReactionSequencing by synthesiswith reversible terminatorsImaging after each cycle(MetzkerM,2010)14

9/12/16Part 3The FutureSingle-Molecule Sequencing(Third-Generation Sequencing)PacBio SequencingPacBio RSIIwww.pacb.com15

9/12/16PacBio SequencingSingle Molecule, Real-Time (SMRT) SequencingDNApolymerasePacBio SequencingAdvantages No amplification required Fast ( 1 nucleotide per second) Long reads (10,000-15,000 bases vs. 300-500 bases for Illumina)Disadvantages Lower throughput (35,000-70,000 reads per run) Lower sequence yield ( 5% of Illumina) High sequencing error rate (single pass 13% vs. 0.1%)16

9/12/16Nanopore SequencingPhi29polymeraseHemolysinElectric field because ofdifferences in ion concentrationacross the membraneDNA moving through pore affectsion current in a base-specificmanner (‘electric signature’)Changes in current aremeasured and recorded todetermine the DNA sequenceElectricfield(Nature Biotechnology 30, 326–328, 2012)Oxford Nanopore Technologies: MinIonReal-time, long reads, but low through-put and high error rateForbes.com17

9/12/16The Future: Solid-state Nanopore Sequencing(Nature 467, 164–165, 2010)The McDermott NGS tion-sequencing-core/18

(Next-Generation Sequencing) 9/12/16 10 Impact of Next-Generation Sequencing Illumina NextSeq Flow Cell 400,000,000 DNA fragments X 300 nucleotides 120,000,000,000 nucleotides in 29 hours . 9/12/16 11 Illumina Sequencing Benchmarks NextSeq 500 1 Technician 29 hours 4000