The Genetic Code - WordPress
Ch 17 HWCh 17 HWThe Genetic CodeDNA is transcribed to messenger RNA (mRNA), and the mRNA is translated to proteins on the ribosomes. A sequence of three nucleotides on an mRNA moleculeis called a codon. As you can see in the table, most codons specify a particular amino acid to be added to the growing protein chain. In addition, one codon(shown in blue) codes for the amino acid methionine and functions as a “start” signal. Three codons (shown in red) do not code for amino acids, but insteadfunction as “stop” CysUCUAG Stop UGG Trp GAUC IleGUCUGCCAUAUUGUUUGUUCGCAGMet orstartTyrCCUCCGAUAGUAA Stop UGA Stop ArgGGUGGAAGAGALysCGUGlyCAGPart A Understanding the genetic codeUse the table to sort the following ten codons into one of the three bins, according to whether they code for a start codon, an in sequence amino acid, or astop codon.Drag each item to the appropriate bin.Hint 1. How to interpret the table of codonsThe table of codons shows the start codon in blue and the three stop codons in red. All other codons (shown in black) appear in the middle of theamino acid sequences that make up proteins.To read the table, locate the first letter in the codon on the left side of the table, then locate the second letter along the top, and the third letter downthe right side of the table. Follow those letters across and down to identify the amino acid associated with that three letter codon.Hint 2. What is the start codon?Identify the start codon.ANSWER:AUGHint 3. What are the stop codons?Enter the three stop codons, separated by commas.ANSWER:UAG, UGA, UAAANSWER:1/46
Ch 17 HWResetstart/methioninestop codonamino y every mRNA gene that codes for a protein begins with the start codon, AUG, and thus begins with a methionine. Nearly every protein codingsequence ends with one of the three stop codons (UAA, UAG, and UGA), which do not code for amino acids but signal the end of translation.Part B Translation of mRNADuring translation, nucleotide base triplets (codons) in mRNA are read in sequence in the 5’ 3’ direction along the mRNA. Amino acids are specified by thestring of codons. What amino acid sequence does the following mRNA nucleotide sequence specify?′5 AUGGCAAGAAAA 3′Express the sequence of amino acids using the three letter abbreviations, separated by hyphens (e.g., Met Ser Thr Lys Gly).Hint 1. How to approach the problemFirst, subdivide the sequence into the individual three letter codons. Then, refer to the table of codons to find the three letter abbreviation for the aminoacid that corresponds to each codon.Hint 2. An example problemThis chart shows how to decode an example mRNA sequence. Labels indicating directionality (for example, 5’ 3’) are not needed when writingamino acid sequences.Example mRNA sequence′5 AUGUCGACUAAGGGA 3Codon sequenceAUGUCGAmino acid sequence(three letter abbreviation)MetSerACUThrAAGLys′GGAGlyHint 3. Can you identify the individual codons in the mRNA sequence?To identify the amino acids specified by the mRNA sequence, you first need to subdivide the sequence into codons of three nucleotides each. Thiscan be done by placing a space between each codon. Which of the following is the correct division of the codons for the sequence given? Look for thecorrect placement of spaces.ANSWER:2/46
Ch 17 HW′′′′5 A UGG CAA GAA AA 35 AU GGC AAG AAA A 3′′′′′′5 AUG GCA AGA AAA 35 AUGG CAA GAA AA 35 AU GGCA AGAA AA 3Hint 4. Can you decode GCA?Which amino acid does the codon GCA code for?Express your answer using the three letter abbreviation of the amino acid.ANSWER:AlaANSWER:Met Ala Arg LysCorrectAn amino acid sequence is determined by strings of three letter codons on the mRNA, each of which codes for a specific amino acid or a stop signal.The mRNA is translated in a 5’ 3’ direction.Part C The role of DNA in determining amino acid sequencesBefore a molecule of mRNA can be translated into a protein on the ribosome, the mRNA must first be transcribed from a sequence of DNA.What amino acid sequence does the following DNA nucleotide sequence specify?′3 TACAGAACGGTA 5′Express the sequence of amino acids using the three letter abbreviations, separated by hyphens (e.g., Met Ser His Lys Gly).Hint 1. How to approach the problemFollow these steps to convert a DNA sequence into an amino acid sequence.1. First, transcribe the DNA sequence to determine the mRNA sequence. Be sure to remember the following:The mRNA strand is complementary to the DNA strand.Uracil (U) takes the place of thymine (T) in RNA to pair with A on the DNA.The RNA is assembled in an antiparallel direction to the template strand of DNA. A 3’ 5’ direction in DNA is transcribed ina 5’ 3’ direction in RNA.2. Next, subdivide the mRNA sequence into the individual three letter codons in the 5’ to 3’ direction.3/46
Ch 17 HW3. Then, refer to the table of codons to identify the three letter abbreviation for the amino acid that corresponds to each codon.Hint 2. An example problemThis chart shows how to decode an example DNA sequence. Remember to first determine the mRNA sequence that is complementary to the DNAtemplate strand’s sequence. Be sure to write the mRNA sequence in a 5’ to 3’ direction, and to use U to pair with A.Example DNA sequence (template strand)3 TACGAATCAGCTGTA 5Complementary DNA sequence5 ATGCTTAGTCGACAT 3′′′′mRNA sequence5 AUGCUUAGUCGACAU 3Codon sequenceAUGAmino acid sequence (three letter abbreviation)Met′CUUAGULeuSerCGAArg′CAUHisHint 3. What mRNA sequence is transcribed from the DNA sequence?What mRNA nucleotide sequence would be transcribed from the DNA sequence in this problem?′3 TACAGAACGGTA 5′ANSWER:′5 ATGTCTTGCCAT 3′′′′′′′3 TACAGAACGGTA 53 AUGUCUUGCCAU 55 AUGUCUUGCCAU 3ANSWER:Met Ser Cys HisCorrectBefore mRNA can be translated into an amino acid sequence, the mRNA must first be synthesized from DNA through transcription. Base pairing inmRNA synthesis follows slightly different rules than in DNA synthesis: uracil (U) replaces thymine (T) in pairing with adenine (A). The codons specifiedby the mRNA are then translated into a string of amino acids.Chapter 17 Pre Test Question 4Part AWhat is the function of RNA polymerase?Hint 1.Compare RNA polymerase to DNA polymerase.ANSWER:It adds nucleotides to the 5' end of the growing mRNA molecule.It relies on other enzymes to unwind the double helix.It proceeds slowly along the DNA strand, requiring about a minute to add two nucleotides to the growing mRNA molecule.It unwinds the double helix and adds nucleotides to a growing strand of RNA.All of the above.4/46
Ch 17 HWCorrectRNA polymerase has several functions in transcription, including unwinding the DNA double helix and adding RNA nucleotides.Protein Synthesis (1 of 3): Overview (BioFlix tutorial)In eukaryotic cells, the nuclear DNA codes for the synthesis of most of the cell’s proteins. Each step of protein synthesis occurs in a specific part of the cell. Inaddition, various forms of RNA play key roles in the processes of protein synthesis.Before beginning this tutorial, watch the Protein Synthesis animation. Pay particular attention to the cellular locations where the various steps of protein synthesisoccur in eukaryotic cells, as well as the different types of RNA and how they function.Part A Locations of the processes involved in protein synthesisIn eukaryotic cells, the processes of protein synthesis occur in different cellular locations.Drag the labels to the appropriate targets to identify where in the cell each process associated with protein synthesis takes place.Hint 1. Some cellular components involved in protein synthesis move through the nuclear poresThe nuclear pores are holes in the nuclear envelope that permit many types of large molecules or aggregates of molecules to move between thenucleus and the cytoplasm. Two cellular components that pass through the nuclear pores are ribosomal subunits and fully processed RNA. What canyou infer about where these cellular components are made?Hint 2. What occurs during some key processes of protein synthesis?Match these key processes involved in protein synthesis to descriptions of what occurs at each step.ANSWER:ResetHelp1. The formation of a strand of RNA that is complementary to one strand of the nuclear DNA is calledtranscription .2. The attachment of a free amino acid to a specific RNA molecule is the key step incharging of tRNA .3. In translation , the nucleotide sequence of a piece of RNA is converted into a sequence of aminoacids in a polypeptide.4. The final RNA template for protein synthesis in eukaryotes is different from the RNA that wasproduced from the DNA template because of RNA processing .5/46
Ch 17 HWHint 3. Where are cytoplasmic and secreted proteins made?In a eukaryotic cell, most proteins remain in the cytoplasm after they are synthesized (for example, the enzymes involved in glycolysis). However,some proteins, such as insulin, must be exported (secreted) from the cell to function.Both cytoplasmic and secreted proteins can only be synthesized in the presence of a ribosome. This diagram shows the two kinds of ribosomes:free ribosomes, which are found in the cytoplasmbound ribosomes, which are found on the membrane of the rough endoplasmic reticulum (ER)Which statement correctly describes where cytoplasmic and secreted proteins are synthesized?ANSWER:Cytoplasmic proteins are synthesized on ribosomes bound to the rough ER, whereas secreted proteins are synthesized on free ribosomes.Cytoplasmic proteins are synthesized on free ribosomes, whereas secreted proteins are synthesized on ribosomes bound to the rough ER.Both cytoplasmic and secreted proteins are synthesized on ribosomes bound to the rough ER.Both cytoplasmic and secreted proteins are synthesized on free ribosomes.ANSWER:CorrectPart B Roles of RNA in protein synthesis in eukaryotesRNA plays important roles in many cellular processes, particularly those associated with protein synthesis: transcription, RNA processing, and translation.6/46
Ch 17 HWDrag the labels to the appropriate bins to identify the step in protein synthesis where each type of RNA first plays a role. If an RNA does not play arole in protein synthesis, drag it to the “not used in protein synthesis” bin.Hint 1. The role of RNA primersDNA synthesis (replication) and RNA synthesis differ in their needs for primer molecules.In DNA replication, DNA polymerase cannot initiate the formation of a new strand of DNA directly from DNA nucleotides alone. Instead,the process requires an RNA primer to which the nucleotides of the new DNA strand attach.In RNA synthesis, in contrast, RNA polymerase can initiate the formation of a new strand of RNA without any primers.This information should help you sort the “RNA primers” label in this problem.Hint 2. How do tRNA and rRNA function in protein synthesis?Both tRNA (transfer RNA) and rRNA (ribosomal RNA) play essential roles in protein synthesis.Which two statements correctly describe the roles of tRNA and rRNA in protein synthesis?ANSWER:rRNA is the major structural component of ribosomes and is involved in binding both mRNA and tRNAs.tRNAs implement the genetic code, translating information from a sequence of nucleotides to the sequence of amino acids that make up aprotein.rRNA has many variations, each of which binds a specific amino acid.tRNA transfers a nucleotide sequence from the DNA in the nucleus to the site of protein synthesis in the cytoplasm.Hint 3. What is the role of mRNA in protein synthesis?mRNA (messenger RNA) plays a key role in protein synthesis as the intermediate between the information encoded by a sequence of bases in DNA (agene) and the sequence of amino acids that make up the protein product.Which three statements correctly describe the role that mRNA plays in protein synthesis in eukaryotes?ANSWER:mRNA is the template for protein synthesis in translation.mRNA carries genetic information from the nucleus to the cytoplasm.mRNA links together amino acids, forming a polypeptide chain.mRNA is the immediate product of transcription.mRNA is produced only after the steps of RNA processing.Hint 4. snRNAs and RNA processingOne stage of RNA processing in eukaryotes involves the removal of introns non coding regions interspersed within the coding regions of the pre mRNA. In this RNA splicing process, the machinery that catalyzes the removal of introns (called the spliceosome) is composed of proteins andsnRNAs (small nuclear RNAs).The snRNAs (and associated proteins) have two functions in the splicing process:to bind to specific sequences of RNA that specify the location of the intron in the pre mRNA, andto catalyze the splicing process itself.ANSWER:7/46
Ch 17 HWResettranscription/RNA processingpre mRNAsnRNAtranslationmRNAHelpnot used in protein synthesistRNArRNARNA primersCorrectIn eukaryotes, pre mRNA is produced by the direct transcription of the DNA sequence of a gene into a sequence of RNA nucleotides. Before this RNAtranscript can be used as a template for protein synthesis, it is processed by modification of both the 5' and 3' ends. In addition, introns are removedfrom the pre mRNA by a splicing process that is catalyzed by snRNAs (small nuclear RNAs) complexed with proteins.The product of RNA processing, mRNA (messenger RNA), exits the nucleus. Outside the nucleus, the mRNA serves as a template for protein synthesison the ribosomes, which consist of catalytic rRNA (ribosomal RNA) molecules bound to ribosomal proteins. During translation, tRNA (transfer RNA)molecules match a sequence of three nucleotides in the mRNA to a specific amino acid, which is added to the growing polypeptide chain.RNA primers are not used in protein synthesis. RNA primers are only needed to initiate a new strand of DNA during DNA replication.Part C Codon size and the genetic codeLife as we know it depends on the genetic code: a set of codons, each made up of three bases in a DNA sequence and corresponding mRNA sequence, thatspecifies which of the 20 amino acids will be added to the protein during translation.Imagine that a prokaryote like organism has been discovered in the polar ice on Mars. Interestingly, these Martian organisms use the same DNA RNA protein system as life on Earth, except thatthere are only 2 bases (A and T) in the Martian DNA, andthere are only 17 amino acids found in Martian proteins.Based on this information, what is the minimum size of a codon for these hypothetical Martian life forms?Hint 1. What mathematical equation can you use to solve this problem?A simple mathematical equation can correctly express the maximum number of codons that can be constructed from x different bases, with a codonlength of y bases. Recall that for life on Earth,there are 4 different bases (A, T, G, and C),a codon is 3 bases long, andthere are a total of 64 possible codons that specify the 20 different amino acids (some amino acids are specified by more than oneamino acid). This chart shows this redundancy in the genetic code for life on Earth.UUUUUUUCUUAUUGPheLeuC CUU LeuCAUCUUCCUCAUCGUAUSerUACGTyrUGUUGCCysUCUAA Stop UGA Stop AUAG Stop UGG Trp GCCU Pro CAUHisCGU Arg UCUCCCCCACCGCCCUACCACAA Gln CGAA8/46
Ch 17 HWACUGCCGCAGCGGAUUACUAAUAGUAUC IleACCAUAACAAUGGMet GGUGGCUGUGlyCAGWhich of the following equations can be used to calculate the maximum number of codons (N) that can be constructed from x differentbases when there are y bases per codon?ANSWER:N 16(3x/y)N xyN 4x(y 1)N xyHint 2. How can you solve this problem without using a mathematical equation?It is possible to solve this problem by simply listing all the possible combinations of bases for a given codon length. In the hypothetical Martianexample there are only 2 different bases (A and T). For a codon length of 1 base, there would only be 2 possible codons:A or TFor a codon length of 2 bases, there would be 4 possible codons:AA; TA; AT; or TTHow many different Martian codons are possible if the codon length is 4 bases?ANSWER:12163264ANSWER:2 bases3 bases4 bases5 bases6 basesThe answer cannot be determined from the information provided.9/46
Ch 17 HWCorrectIn the most general case of x bases and y bases per codon, the total number of possible codons is equal to x y .In the case of the hypothetical Martian life forms, is the minimum codon length needed to specify 17 amino acids is 5 (25 32), with some redundancy(meaning that more than one codon could code for the same amino acid).For life on Earth, x 4 and y 3; thus the number of codons is 43, or 64. Because there are only 20 amino acids, there is a lot of redundancy in thecode (there are several codons for each amino acid).Protein Synthesis (2 of 3): Transcription and RNA Processing (BioFlix tutorial)In the process of transcription, the genetic informationencoded in the sequence of bases that makes up a gene is“transcribed,” or copied in the same language, into a strandof RNA bases. The enzyme that catalyzes this reaction iscalled an RNA polymerase.Transcription.In eukaryotes, before the resulting strand (called pre mRNA) leaves the nucleus, it is processed in severalways. The product of this processing is the mRNA thatfunctions as the template for protein synthesis outside thenucleus.Before beginning this tutorial, watch the Transcription andRNA Processing animations. Pay particular attention to thebase pairing that occurs during transcription and thevarious steps involved in RNA processing.RNA Processing.Part A Transcription of the DNA base sequence to RNASuppose that a portion of double stranded DNA in the middle of a large gene is being transcribed by an RNA polymerase. As the polymerase moves throughthe sequence of six bases shown in the diagram below, what is the corresponding sequence of bases in the RNA that is produced?Enter the sequence of bases as capital letters with no spaces and no punctuation. Begin with the first base added to the growing RNA strand, andend with the last base added.Hint 1. DNA to RNA base pairing rulesThough the four nucleotide bases used to construct DNA are adenine (A), thymine (T), guanine (G), and cytosine (C), in RNA, the base uracil (U) issubstituted for thymine.Thus, the base pairing rules in transcription are A U, T A, C G, and G C, where the first base is the coding base in the template strand of theDNA and the second base is the base that is added to the growing mRNA strand.10/46
Ch 17 HWHint 2. What are the coding strand and the template strand?Double stranded DNA is composed of two complementary strands of DNA. “Complementary” means that the bases on one strand pair in a specificway with the bases on the other strand: A with T and G with C. In a given gene, one strand of the DNA functions as the template strand, and the otheris the coding strand.Which two statements correctly describe the template and/or coding strands?ANSWER:The four types of bases that are used in the coding strand are different from the types that are used in the template strand.As the RNA polymerase moves along the DNA, the DNA bases on the coding strand are copied, producing the identical sequence of basesin the RNA transcript.The template and coding strands are always antiparallel; that is, if one strand has its 3' end on the left and its 5' end on the right, the otherstrand has the opposite orientation.During transcription, the DNA bases on the template strand are paired with their complementary RNA bases to form the RNA transcript.Hint 3. Does RNA polymerase move in a set direction along the DNA during transcription?RNA polymerase produces an RNA molecule from one of the two strands of DNA by transcribing the
Protein Synthesis (1 of 3): Overview (BioFlix tutorial) In eukaryotic cells, the nuclear DNA codes for the synthesis of most of the cell’s proteins. Each step of protein synthesis occurs in a specific part of the cell. In addition, various forms of RNA play key roles in the processes of protein synthesis. Before beginning this tutorial, watch .
May 02, 2018 · D. Program Evaluation ͟The organization has provided a description of the framework for how each program will be evaluated. The framework should include all the elements below: ͟The evaluation methods are cost-effective for the organization ͟Quantitative and qualitative data is being collected (at Basics tier, data collection must have begun)
Silat is a combative art of self-defense and survival rooted from Matay archipelago. It was traced at thé early of Langkasuka Kingdom (2nd century CE) till thé reign of Melaka (Malaysia) Sultanate era (13th century). Silat has now evolved to become part of social culture and tradition with thé appearance of a fine physical and spiritual .
On an exceptional basis, Member States may request UNESCO to provide thé candidates with access to thé platform so they can complète thé form by themselves. Thèse requests must be addressed to esd rize unesco. or by 15 A ril 2021 UNESCO will provide thé nomineewith accessto thé platform via their émail address.
̶The leading indicator of employee engagement is based on the quality of the relationship between employee and supervisor Empower your managers! ̶Help them understand the impact on the organization ̶Share important changes, plan options, tasks, and deadlines ̶Provide key messages and talking points ̶Prepare them to answer employee questions
Dr. Sunita Bharatwal** Dr. Pawan Garga*** Abstract Customer satisfaction is derived from thè functionalities and values, a product or Service can provide. The current study aims to segregate thè dimensions of ordine Service quality and gather insights on its impact on web shopping. The trends of purchases have
Chính Văn.- Còn đức Thế tôn thì tuệ giác cực kỳ trong sạch 8: hiện hành bất nhị 9, đạt đến vô tướng 10, đứng vào chỗ đứng của các đức Thế tôn 11, thể hiện tính bình đẳng của các Ngài, đến chỗ không còn chướng ngại 12, giáo pháp không thể khuynh đảo, tâm thức không bị cản trở, cái được
The Genetic Code and DNA The genetic code is found in a acid called DNA. DNA stands for . DNA is the genetic material that is passed from parent to and affects the of the offspring. The Discovery of the Genetic Code FRIEDRICH MIESCHER Friedrich Miescher discovered in white blood . The Discovery of the Genetic Code MAURICE WILKINS
Le genou de Lucy. Odile Jacob. 1999. Coppens Y. Pré-textes. L’homme préhistorique en morceaux. Eds Odile Jacob. 2011. Costentin J., Delaveau P. Café, thé, chocolat, les bons effets sur le cerveau et pour le corps. Editions Odile Jacob. 2010. Crawford M., Marsh D. The driving force : food in human evolution and the future.
