Illumina Adapter Sequences - UC Davis
Illumina Adapter SequencesIllumina Adapter SequencesThis document provides the nucleotide sequences that comprise Illumina oligonucleotides used inIllumina sequencing technologies. These sequences are provided for the sole purpose of understandingand publishing the results of your sequencing experiments.Proprietary to IlluminaThe oligonucleotides are proprietary to Illumina. Their manufacture, use, and sequence information areprotected by intellectual property, including issued or pending patents, copyright, and trade secrets.Illumina reserves all rights in the oligonucleotides and their sequence information, except for the strictlylimited permissions as follows.Most Illumina oligonucleotides are specially modified and purified in a proprietary manner to enable andoptimize their performance with Illumina instruments. Illumina is the only authorized supplier of the oligos.Illumina has no control over the quality, composition, or compatibility of reagents from unauthorizedsuppliers. We cannot troubleshoot or provide other support for experiments performed with unauthorizedreagents, and we cannot guarantee the performance of Illumina products when used with such reagents.Limited PermissionsYour permission to copy or distribute sequence information is limited to within your institution for use onlywith Illumina instruments and associated equipment, consumables, and software. You may not copy ordistribute this information outside your institution, except under the following circumstances. You may distribute outside your institution and publish the sequence information in presentations,manuscripts, or publications authored by you, if the following copyright notice is included:Oligonucleotide sequences 2015 Illumina, Inc. All rights reserved. If you modify or adapt any sequence information contained in this letter and distribute or publish themodified sequences, you must include the following copyright notice:Oligonucleotide sequences 2015 Illumina, Inc. All rights reserved. Derivative works createdby Illumina customers are authorized for use with Illumina instruments and products only. Allother uses are strictly prohibited.For all other uses of the sequence information or for questions on custom oligonucleotides, pleasecontact Illumina to discuss the permissions or licenses that might be required.Document # 1000000002694 v00October 20151
Illumina Adapter SequencesContentsTruSight Amplicon Panels .5Index 1 (i7) Adapters . 5Index 2 (i5) Adapter . 5TruSight Cardio .6Index 1 (i7) Adapters . 6Index 2 (i5) Adapter . 6TruSight One .6Index 1 (i7) Adapters . 6Index 2 (i5) Adapter . 7TruSight Rapid Capture .7Index 1 (i7) Adapters . 7Index 2 (i5) Adapter . 8TruSight Tumor 15 .8Index 1 (i7) Adapters . 8Index 2 (i5) Adapter . 9Illumina Nextera Library Prep Kits .10Nextera Transposase Adapters . 10Nextera Index Kit – PCR Primers . 10Nextera Index Kit - Index 1 (i7) Adapters. 10Nextera Index Kit - Index 2 (i5) Adapters. 11Nextera XT Index Kit v2 - Index 1 (i7) Adapters. 11Nextera XT Index Kit v2 - Index 2 (i5) Adapters. 12TruSeq Amplicon Kits .14Index 1 (i7) Adapters . 14Index 2 (i5) Adapter . 14TruSeq HT Kits .15D501–D508 Adapters . 15D701–D712 Adapters . 15Index 1 (i7) Adapters . 15Index 2 (i5) Adapters . 15TruSeq LT Kits and TruSeq v1/v2 Kits .16TruSeq Universal Adapter . 16TruSeq Index Adapters (Index 1–27) . 16TruSeq Synthetic Long-Read DNA .18Long Reads Adapter . 18TruSeq Small RNA .18Document # 1000000002694 v00October 20152
Illumina Adapter SequencesRNA 5’ Adapter (RA5) . 18RNA 3’ Adapter (RA3) . 18Stop Oligo (STP) . 18RNA RT Primer (RTP) . 18RNA PCR Index Primers (RPI1–RPI48) . 18TruSeq Targeted RNA Expression .21Index 1 (i7) Adapters . 21Index 2 (i5) Adapter . 22Process Controls for TruSeq Kits .23Nextera DNA Sample Prep Kit (Epicentre Biotechnologies) .29Transposon Sequences . 29Adapters (showing optional bar code) . 29PCR Primers . 29Oligonucleotide Sequences for Genomic DNA .29Adapters . 29PCR Primers . 29Genomic DNA Sequencing Primer . 29Oligonucleotide Sequences for Paired End DNA .30PE Adapters . 30PE PCR Primer 1.0 . 30PE PCR Primer 2.0 . 30PE Read 1 Sequencing Primer . 30PE Read 2 Sequencing Primer . 30Oligonucleotide Sequences for the Multiplexing Sample Prep Oligo Only Kit30Multiplexing Adapters . 30Multiplexing PCR Primer 1.0 . 30Multiplexing PCR Primer 2.0 . 30Multiplexing Read 1 Sequencing Primer . 30Multiplexing Index Read Sequencing Primer . 30Multiplexing Read 2 Sequencing Primer . 31PCR Primer Index Sequences 1–12 . 31Oligonucleotide Sequences for the v1 and v1.5 Small RNA Kits .31RT Primer . 315' RNA Adapter . 323' RNA Adapter . 32v1.5 Small RNA 3' Adapter . 32Small RNA PCR Primer 1 . 32Small RNA PCR Primer 2 . 32Document # 1000000002694 v00October 20153
Illumina Adapter SequencesSmall RNA Sequencing Primer. 32Revision History .33Document # 1000000002694 v00October 20154
Illumina Adapter SequencesTruSight Amplicon PanelsIncludes TruSight Myeloid Sequencing Panel and TruSight Tumor 26Index 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 508TAGACCTATAGGTCTADocument # 1000000002694 v00October 20155
Illumina Adapter SequencesTruSight CardioIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 3000/4000A505GTAAGGAGCTCCTTACTruSight OneIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample AGCDocument # 1000000002694 v00October 20156
Illumina Adapter Sequencesi7 Index Namei7 Bases for Sample AIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 504AGAGTAGATCTACTCTA505GTAAGGAGCTCCTTACTruSight Rapid CaptureIncludes TruSight Autism, TruSight Cancer, and TruSight Inherited DiseaseIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample AGCN705GGACTCCTN706TAGGCATGN707CTCTCTACDocument # 1000000002694 v00October 20157
Illumina Adapter Sequencesi7 Index Namei7 Bases for Sample GCAN712GTAGAGGAIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 506ACTGCATATATGCAGTE517GCGTAAGATCTTACGCTruSight Tumor 15Index 1 (i7) Adaptersi7 Index Namei7 Bases for Sample GCTACR712CTTGTADocument # 1000000002694 v00October 20158
Illumina Adapter Sequencesi7 Index Namei7 Bases for Sample ATGGCR735CATTTTR736CCAACAR749GATGCTIndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq ocument # 1000000002694 v00October 20159
Illumina Adapter SequencesIllumina Nextera Library Prep KitsIncludes Nextera DNA, Nextera XT, Nextera Enrichment (obsolete), and Nextera Rapid CaptureNextera Transposase Adapters(Used for Nextera tagmentation)Read 15’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGRead 25’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNextera Index Kit – PCR PrimersIndex 1 Read5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGIndex 2 Read5’ tera Index Kit - Index 1 (i7) Adaptersi7 Bases in Adapteri7 Index Namei7 Bases for Sample ent # 1000000002694 v00October 201510
Illumina Adapter SequencesNextera Index Kit - Index 2 (i5) AdaptersThe i5 index names vary for different Nextera products as follows: N50x—Nextera DNAS50x—Nextera XTE50x—Nextera Enrichment and Nextera Rapid Capturei5 Bases in Adapteri5 Bases for Sample Sheet i5 Bases for Sample Sheeti5 Index Name HiSeq 2000/2500 and MiSeq NextSeq and HiSeq CGTAAGATCTTACGCNextera XT Index Kit v2 - Index 1 (i7) Adaptersi7 Bases in Adapteri7 Index Namei7 Bases for Entry on Sample GAGGATCATGAGCN714GCTCATGADocument # 1000000002694 v00October 201511
Illumina Adapter Sequencesi7 Bases in Adapteri7 Index Namei7 Bases for Entry on Sample CGAN729TCGACGTCNextera XT Index Kit v2 - Index 2 (i5) Adaptersi5 Bases in Adapteri5 Bases for Sample Sheet i5 Bases for Sample Sheeti5 Index Name HiSeq 2000/2500 and MiSeq NextSeq and HiSeq 6CCTAGAGTACTCTAGGDocument # 1000000002694 v00October 201512
Illumina Adapter Sequencesi5 Bases in Adapteri5 Bases for Sample Sheet i5 Bases for Sample Sheeti5 Index Name HiSeq 2000/2500 and MiSeq NextSeq and HiSeq ocument # 1000000002694 v00October 201513
Illumina Adapter SequencesTruSeq Amplicon KitsTruSeq Custom Amplicon 1.5, TruSeq Amplicon Cancer Panel, and TruSeq Custom Amplicon Low InputIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adapteri5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 508TAGACCTATAGGTCTADocument # 1000000002694 v00October 201514
Illumina Adapter SequencesTruSeq HT KitsIncludes TruSeq DNA PCR-Free HT, TruSeq Nano HT, TruSeq Stranded mRNA HT, and TruSeq TotalRNA HTD501–D508 CCCTACACGACGCTCTTCCGATCTD701–D712 GTATGCCGTCTTCTGCTTGIndex 1 (i7) Adaptersi7 Index Namei7 Bases for Sample ndex 2 (i5) Adaptersi5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq 503CCTATCCTAGGATAGGDocument # 1000000002694 v00October 201515
Illumina Adapter Sequencesi5 Index Namei5 Bases for Sample SheetHiSeq 2000/2500 and MiSeqi5 Bases for Sample SheetNextSeq and HiSeq CGTCAGTACTruSeq LT Kits and TruSeq v1/v2 KitsIncludes TruSeq DNA PCR-Free LT, TruSeq Nano DNA LT, TruSeq DNA v1/v2/LT (obsolete), TruSeqRNA v1/v2/LT, TruSeq Stranded mRNA LT, TruSeq Stranded Total RNA LT, TruSeq RNA Access, andTruSeq ChIPIndex sequences are 6 bases as underlined. Enter the underlined 6 bases on the sample sheet.TruSeq Universal Adapter5’ TCCGATCTTruSeq Index Adapters (Index 1–27)Index numbers 17, 24, and 26 are reserved.TruSeq Adapter, Index 15’ CGTCTTCTGCTTGTruSeq Adapter, Index 25’ CGTCTTCTGCTTGTruSeq Adapter, Index 35’ CGTCTTCTGCTTGTruSeq Adapter, Index 45’ CGTCTTCTGCTTGTruSeq Adapter, Index 55’ CGTCTTCTGCTTGTruSeq Adapter, Index 65’ CGTCTTCTGCTTGTruSeq Adapter, Index 75’ CGTCTTCTGCTTGDocument # 1000000002694 v00October 201516
Illumina Adapter SequencesTruSeq Adapter, Index 85’ CGTCTTCTGCTTGTruSeq Adapter, Index 95’ CGTCTTCTGCTTGTruSeq Adapter, Index 105’ CGTCTTCTGCTTGTruSeq Adapter, Index 115’ CGTCTTCTGCTTGTruSeq Adapter, Index 125’ CGTCTTCTGCTTGTruSeq Adapter, Index 135’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 145’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 155’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 165’ GCCGTCTTCTGCTTGTruSeq Adapter, Index 185’ GCCGTCTTCTGCTTGTruSeq Adapter
Illumina Adapter Sequences Document # 1000000002694 v00 1 October 2015 Illumina Adapter Sequences. This document provides the nucle
3825-34, Chrysler 3 Adapter 3825-12, Ford EEC Adapter 3825-16, Ford ABS Adapter 3421-93, Kia Adapter 3825-11, MECS ABS Adapter 3825-13, Geo-Isuzu Adapter 3825-14, Mazda MECS Adapter 3825-15, Universal 9 Pin Adapter 3825-17, Toyota DCL 1/ Adapter 3825-18, Toyota DCL 2/ Adapter 3825-19, Mitsubishi/ Chrysler “Y” Adpater 3825-20, Nissan 1 Adapter
DAM-G 52 Male Adapter DAM-U 53 Male Adapter DAM-UO 53 Female Adapter DAF-N 54 Female Adapter DAF-R 55 Female Adapter DAF-GR 55 Female Gauge Adapter DAF-GG 56 Elbow Adapter DLA 57 Run Tee Adapter DTRA 57 Branch Tee Adapter DTBA 57 All dimensions are in millimeters unless othe
Jeff Davis County - Jeff Davis Pre-K, Jeff Davis Learning Center, Mt. Zion Learning Center, Head Start, Jeff Davis Primary, Jeff Davis Elementary, Jeff Davis Middle, Jeff Davis High 3 Literacy Assessments. The JDCSS student assessment system is arranged in three tiers consisting of state-mandated, district-level, and building-level assessments.
HTC Power Bank (BB G1000) HTC Wall adapter (TC P5000-AU) HTC Wall adapter (TC P5000-CN) HTC Wall adapter (TC P5000-EU) HTC Wall adapter (TC P5000-IN) HTC Wall adapter (TC P5000-UK) HTC Wall adapter (TC P5000-US) IDMIX Power Mint 10000 iKits Power Bank (PBM-G-Q50B) iKits Wall Adapter (W0920X-1U02F) Imazing Power .
Understand the Salesforce Adapter. Salesforce Adapter Capabilities1-1. Salesforce Adapter Restrictions1-2. What Application Version Is Supported?1-3. Salesforce Adapter Use Cases1-3. Workflow to Create and Add a Salesforce Adapter Connection to an Integration1-3. Create a Salesforce Adapter Connection. Prerequisites for Creating a Connection2-1
Davis, Davis Arts Center, 530-756-4100 Davis, International House Davis, 530-753-5007 Davis, Pence Gallery, 530-758-3370 Davis, UC Davis Arboretum and Public Garden, 530-752-4880 Desert Hot Springs, Cabot's Pueblo Museum, 760-329-7610 Durham, Patrick Ranch Museum, 530-342-4359 El Segundo, Automobile Driving Museum 310-909-0950
Davis, Davis Arts Center, 530-756-4100 Davis, International House Davis, 530-753-5007 Davis, Pence Gallery, 530-758-3370 Davis, UC Davis Arboretum and Public Garden, 530-752-4880 Desert Hot Springs, Cabot's Pueblo Museum, 760-329-7610 Durham, Patrick Ranch Museum, 530-342-4359 El Segundo, Automobile Driving Museum 310-909-0950
The Organization of Behavior has played a significant part in the development of behavioural neuroscience for the last 70years. This book introduced the concepts of the “Hebb synapse”, the “Hebbian cell assembly” and the “Phase sequence”. The most frequently cited of these is the Hebb synapse, but the cell assembly may be Hebb’s most important contribution. Even after 70years .
