Wednesday Oct 11 - Ch 8 -Brock

Systems MicrobiologyWednesday Oct 11 - Ch 8 -BrockRegulation of cell activity Transcriptional regulation mechanisms Translational regulation mechanisms Bacterial genetics

Image removed due to copyright restrictions.See Figure 8-1 in Madigan, Michael, and John Martinko. Brock Biology of Microorganisms.11th ed. Upper Saddle River, NJ: Pearson Prentice Hall, 2006. ISBN: 0131443291.

Regulation of prokaryotic transcription1.Single-celled organisms with short doubling times must respond extremely rapidly to theirenvironment.2.Half-life of most mRNAs is short (on the order of a few minutes).3.Coupled transcription and translation occur in a single cellular compartment.Therefore, transcriptional initiation is usually the major control point.Most prokaryotic genes are regulated in units called operons (Jacob andMonod, 1960)Operon: a coordinated unit of gene expression consisting of one or more related genes andthe operator and promoter sequences that regulate their transcription. The mRNAs thusproduced are “polycistronic’—multiple genes on a single transcript.Regulatory SequencesGenes Transcribed as a UnitPromoterDNAActivatorBinding SiteABCRepressorBinding Site(Operator)Figure by MIT OCW.

Initiation of transcription begins with promoter binding byRNAP holoenzymeholoenzyme RNAP core SigmaDiagram of RNA polymerase and transcription removed due to copyright restrictions.Brock Biology of Microorganisms, vol. 11, Chapter 7

Alternate Sigma Factorsrecognize promoters of different architecture –different regulons of genesTable and graphs removed due to copyright restrictions.See Ishihama. Ann Rev Microbiol 54 (2000): 499-518.Ishihama, 2000, Ann. Rev. Microbiol. 54:499-518

Transcription factors interact with different components ofRNAP in addition to sigma factor .Diagram removed due to copyright restrictions.See Ishihama. Ann Rev Microbiol 54 (2000): 499-518.Ishihama, 2000, Ann. Rev. Microbiol. 54:499-518

Microbiology 151 (2005), 3147-3150; DOI 10.1099/mic.0.28339-0Genome update: sigma factors in 240 bacterial genomesTypes of sigma factors Graphs removed due to copyright restrictions.

Transcription factorsTypically DNA binding proteins that associate with the regulatedpromoter and either decrease or increase the efficiency oftranscription, repressors and activators, respectively - Asignificant number of regulators do either one depending onconditionsDomain containing protein-protein contacts,holding protein dimer togetherDNA binding domain fits in major groovesand along phosphate CACCTTAACACTCGCCTA T TGTTAAAGTGTGT3'5'Inverted repeats on the DNAFigure by MIT OCW.

In presence of arginine, arginine biosynthesis genes are repressedRepressionRelative IncreaseArginine BiosynthesisNo. cellsTotal proteinArginine addedRepressionEnzymes involvedin arginine synthesisInductionTimeFigure by MIT OCW.

In the presence of lactose, lactose metabolizing genes are inducedInductionRelative IncreaseLactose DegradationNo. cellsTotal proteinβ-GalactosidaseLactose addedTimeFigure by MIT OCW.

The metabolism of lactose in E. coli & the lactose operonGalactoside permeaseLactose To use lactose as an energy source, cells must containthe enzyme β-galactosidase. Utilization of lactose also requires the enzyme lactosepermease to transport lactose into the cell. Expression of these enzymes is rapidly induced 1000-fold when cells are grown in lactose comparedto ationOHOHHHOHCH2OHHHOOOHHOHHHOHAllolactoseHLacZ: β-galactosidase; Y: galactoside permease;A: transacetylase (function unknown).P: promoter; O: operator.LacI: repressor; PI and LacI are not part of the OHOHH HHOOHOHHHOHIPTG: nonmetabolizableartificial inducer(can’t be cleaved)OHHGlucosefigure by MIT OCW.

Negative regulation of the lac operonlac operonRNA polymeraseNegative regulation: The productof the I gene, the repressor,blocks the expression of theZ, Y, and A genes byinteracting with the operator(O).The inducer (lactose or IPTG) canbind to the repressor, whichinduces a conformationalchange in the repressor,thereby preventing itsinteraction with the operator(O). When this happens,RNA polymerase is free tobind to the promoter (P) andinitiates transcription of thelac genes.DNAIPOZYAmRNAlac eLactosepermeaseβ-galactosidaseHow do we know that lacI encodes a trans-acting repressor?NascentpolypeptidechainsFigure by MIT OCW.

Symmetry matching between the tetramers of lac repressor and thenearly palindromic sequence of the lac operatorEach monomeric unit of lacI is 37-kD-10 1 10 20 305' ATGT TGTGTGGAATTGTGAGC GGATAACAATTTCACACAGGAA 3'3' TACAACACACCTTAACACTCGC CTATTGTTAAAGTGTGT CCTT 5'Half-siteFigure by MIT OCW.Image of the X-ray structure of lac repressor tetramer bound to two21-bp segments of DNA removed due to copyright restrictions.The lac operator sequence is a nearly perfectinverted repeat centered around the GC basepair at position 11.

“Diauxic” growth preferential use of one carbon source over another, in sequential fashionNumber of Viable CellsLactose exhaustedGlucose exhaustedGlucoseand lactoseaddedGrowth onlactoseGrowth on glucoseTime of Incubation (hr)Figure by MIT OCW.

Regulation of the lac operon involves more than a simple on/offswitch provided by lacI/lacOObservation: Glucose is a preferred sugar for E. coli, which uses glucoseand ignores lactose in media containing both sugars. In these cells, βgalactosidase level is low, suggesting that derepression at the operator siteis not enough to turn on the lac operon. This phenomenon is calledcatabolite repression.This involves regulation of cyclic AMP (cAMP) levels, and its interactionwith the Catabolite Activator Protein, CAP.cAMP-CAP complex activates lac gene expression.

Cooperative binding of cAMP-CAP and RNAP on the lac promoterRNA polymerasea submitcAMP-CAP-84-50CAP site 1Polymerase siteLac controlregionFigure by MIT OCW.cAMP-CAP contacts the α-subunits of RNAP and enhances the binding of RNAPto the promoter.

X-ray structure of CAPcAMP bound to DNAImage of the X-ray structure of the CAP-cAMP dimer in complexwith DNA removed due to copyright restrictions.

Catabolite control of the lac operon(A)High glucoseInactive adenylate cyclaseNo cAMPATP(B)(a) Under conditions of high glucose, aglucose breakdown product inhibits theenzyme adenylate cyclase, preventing theconversion of ATP into cAMP.(b) As E. coli becomes starved for glucose,there is no breakdown product, andtherefore adenylate cyclase is active andcAMP is formed.Active adenylatecyclaseLow glucoseATPcAMP(C)cAMPcAMP CAPCAP(c) When cAMP (a hunger signal) ispresent, it acts as an allosteric effector,complexing with the CAP dimer.cAMP(D)CAPPOZYAFigure by MIT OCW.CAP sites are also present in other promoters. cAMPCAP is a global catabolite gene activator.(d) The cAMP-CAP complex (not CAPalone) acts as an activator of lac operontranscription by binding to a region withinthe lac promoter. (CAP cataboliteactivator protein; cAMP cyclic adenosinemonophosphate)

Positive and negative regulation of the lac operonGlucose present (cAMP low); no lactoseCAPZPromoterYAOperatorARepressorGlucose present (cAMP low); lactose presentCAPZYAVery little lac mRNAInducer-repressorLactoseBNo glucose present (cAMP high); lactose presentcAMPZCYAAbundant lac mRNAFigure by MIT OCW.

Transcriptional termination can be an important targetfor regulation5'3'3'5'Termination site reached;chain growth stops5'3'5'3'3'Release of polymeraseand RNA5'5'Figure by MIT OCW.

The tryptophan trp operon: two kinds of negative regulationStructural genesControl sitestrp,OmRNA(low trp levels)LeadermRNA(high trp rOperatorTryptophan trp repressor dimerTrp-repressor complex activatedfor DNA binding 1-35Inactive repressorStart of transcriptionTryptophanRNA polymeraseActive repressorBinds Operator; blocks RNAP binding &represses transcription;Tryptophan a co-repressormRNAGenes are ONGenes are OFFFigure by MIT OCW.

Image of trp and DNA removed due to copyright restrictions.

Many genes terminate transcription at sequencesdownstream of the coding sequenceImage removed due to copyright restrictions.See Figure 7-32 in Madigan, Michael, and John Martinko. Brock Biology of Microorganisms.11th ed. Upper Saddle River, NJ: Pearson Prentice Hall, 2006. ISBN: 0131443291.

Attenuation and theTryptophan OperonImage removed due to copyright restrictions.See Figure 8-24 in Madigan, Michael, and John Martinko. Brock Biology of Microorganisms.11th ed. Upper Saddle River, NJ: Pearson Prentice Hall, 2006. ISBN: 0131443291.

Attenuation is mediated by the tight coupling of transcriptionand translation The ribosome translating the trp leader mRNA follows closely behind the RNA polymerasethat is transcribing the DNA template. Alternative conformation adopted by the leader mRNA.High leted1trpL mRNA432 UUU 3,"Terminated"RNA polymeraseRibosome transcribingthe leader peptide mRNAand blocking sequence 2Low tryptophanIncompleteleader peptideAntiterminator21Ribosome stalledat tandem Trp codonstrp operon mRNA3Transcribing RNA polymerase4 The stalledribosome is waitingfor tryptophanyltRNA. The 2:3 pair is notan attenuator and ismore stable thanthe 3:4 pair.DNA encodingtrp operonFigure by MIT OCW.

The arabinose (ara) operon3 genes encoding enzymes of the arabinose degradation pathwayarabinose–––(1) araA L-arabinose isomerase(2) araB L-ribulose kinase(3) araD L-ribulose 5-phosphatearabinose1Regulatory elements–––araO1, araO2araI (I for inducer)PBAD promoterL-ribulose2L-ribulose –5-P3D-xylulose –5-PPentose P Pathway

The arabinose (ara) operon of Escherichia colitPPtCRPO2 O1araCI1 I2araBaraAaraDAraC dimerActivator/RepressorInteraction of AraC with O and I sites determines transcription atthe Ara locus

Key features of Arabinose regulation1. Arabinose is a positive regulator of transcription.2. In the absence of arabinose AraC binds regulatory sites I1 and O2.This represses AraBAD operon transcription (DNA looping).3. AraC levels are autoregulated by excess AraC binding to O14. When arabinose is bound to AraC, AraC binds I1 and I2.5. When Glucose is absent, cAMP levels rise and cAMP-CRP bindadjacent to I1.Together these events trigger AraBAD expression.

ara Transcriptional control-1tPO1 CRPO2I1 I2araCParaBtaraAaraD1. No L-arabinoseO2O2AraC dimer is flexibleP araBADP araCActiverepressedO1I1 I2AraC binds to O2 and I1 repressing P araBADP araCP araBADrepressedrepressedO1I1 I2Excess AraC binds to O1 regulating cellularlevels of AraC protein

ara Transcriptional control-2tO2PO1 CRPPtI1 I2 araBaraCaraAaraD2. Inducer L-arabinose cAMP-CRPtO2P araBAD induced(activated)PO1I1 I2AraC binds to I2 and I1 activating P araBAD

Differences between the arabinose and lactose operons1. AraC can act as both a repressor and activator of AraBAD expression.This is an example of positive control.2. AraC can regulate its own synthesis by repressing its own transcriptionThis is a common feature of many genes.3. Ara operon provides an example of regulation at a distance by DNAlooping.

Common mechanisms of regulation of transcription,with variations on a theme ve, auto-negative O1, O2, O3araO1, O2, ItrpO binose(activator)Effectortrp Rdistanttryptophan(co-repressor)

“Flipping promoters” Flagellar phase variationFlagellarPhase variationFigure by MIT OCW.

Environmentally-responsive adaptationExternal stimuliTransmembranereceptorIndirecteffectInternal GeneRegulation

Simple paradigm for environmental signalling – the twocomponent system 30 such systems in E. coli – also found in plants and fungiImage removed due to copyright restrictions.

Basic model for a two component-regulatory systemSensor histidine kinase (HK) – may or may not be transmembrane –phosphorylates itselfResponse regulator (RR) – often, but not always affects gene expression –phosphorylated by HKHoch and Varughese, 2001, J. Bacteriol. 183:4941-4949