Dietary Supplementation With A High Dose Of Daidzein .
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43DOI 10.1186/s40104-016-0102-zRESEARCHOpen AccessDietary supplementation with a high doseof daidzein enhances the antioxidantcapacity in swine muscle but expertspro-oxidant function in liver and fat tissuesWei Chen1,2,3,4,5, Xianyong Ma1,2,3,4,5*, Yingcai Lin1,2,3,4,5*, Yunxia Xiong1,2,3,4,5, Chuntian Zheng1,2,3,4,5,Youjun Hu1,2,3,4,5, Deqian Yu1,2,3,4,5 and Zongyong Jiang1,2,3,4,5AbstractBackground: Although isoflavones are natural dietary antioxidants, they may have toxicological effects. This studyaimed to evaluate the redox system in tissues of finishing pigs by supplementation with high dose of daidzein(640 mg/kg).Results: The supplementation of high dose of daidzein for 64 d increased the activity of superoxide dismutaseand total antioxidant capacity in longissimus muscle but down-regulated the expression of reactive oxygenspecies (ROS)-producing enzyme NADPH oxidase-2 and cyclooxygenase-2. In contrast, high-level supplementation withdaidzein exerted pro-oxidant changes in back fat, abdominal fat, liver, and plasma, as reflected by increased contents ofmalondialdehyde, a lipid peroxidation product, in these tissues. Furthermore, daidzein supplementationresulted in higher expression of ROS-producing enzymes, including NADPH oxidase-1 and cyclooxygenase-1in liver, 5-lipoxygenase (5-LOX) in backfat and NADPH oxidase-2 both in abdominal fat and backfat. Thesupplementation of daidzein did not affect meat quality parameters in longissimus muscle, including marbling score,eye muscle areas, intramuscular fat, shear force, drip loss, pH and meat color.Conclusions: This experiment suggests that dietary supplementation of finishing pigs with daidzein at a highdose level improves redox status in muscle but exerts pro-oxidant effect in liver and fat tissues.Keywords: Anti-/pro-oxidant enzyme, Daidzein, Fat, Liver, Muscle, PigsBackgroundSoy isoflavones, mainly composed of daidzein, genisteinand glycitein, are known from in vitro studies to be active scavengers of hydrogen peroxide, hence acting aspotential antioxidants. Because of this property [1, 2],isoflavones are considered to be natural dietary antioxidants with interesting benefits to health [3]; there isalso potential for their use in animal production to improve growth performance [4]. There is, however, somecontroversy about the beneficial antioxidant effects ofsoy isoflavones because, for example, genistein and its* Correspondence: lilymxy80@sohu.com; lyc0123@tom.com1Institute of Animal Science, Guangdong Academy of Agricultural Sciences,Guangzhou 510640, People’s Republic of ChinaFull list of author information is available at the end of the articlemethylated derivative, biochanin A, can mobilize nuclear copper in human lymphocytes, leading to degradation of cellular DNA [5]. There is increasing evidencefor both antioxidant and pro-oxidant activities of isoflavones, depending upon the specific experimental conditions [6, 7]. These studies suggest a pro-oxidantpotential of high concentrations of isoflavones.Because of this pro-oxidant potential, one consideration for their application in practical animal production is whether dietary supplementation at high dosesof isoflavones might change the redox system inmuscle, thereby possibly affecting meat quality. Oxidative stress has been shown to reduce collagen solubility [8], possibly affecting toughness of meat. Directevidence of negative consequences of high doses of 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication o/1.0/) applies to the data made available in this article, unless otherwise stated.
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43isoflavones is still scarce in practical animal production. Accordingly, the objective of present study wasto test the effects of dietary supplementation of highdose of the isoflavone daidzein on redox system inskeletal muscle, liver, and back fat and meat quality.The level of supplementation used here, 640 mg/kgfeed, is 15 times higher than that providing optimalantioxidant function [4].Page 2 of 11Table 1 Composition of the basal diet fed to finishing pigs(as-fed basis)ItemContentIngredientCornMethodsThe experimental protocol used in this study, includinganimal management, housing, and slaughter procedures,was approved by the Animal Care and Use Committeeof Guangdong Academy of Agricultural Sciences.68.7Soybean22.1Wheat middlings6.0Monocalcium phosphate0.7Limestone, ground1.0Salt0.4L-Lys.HCl0.1aTrace-mineral premix0.5Vitamin premixb0.5Calculated chemical compositionAnimal and housingDE, MJ/kgA total of 48 hybrid finishing pigs (Duroc Landrace Large White, 24 gilts and 24 barrows) averaging 57 kgBW were obtained from a single source (a commercialswine farm in South China) and transported to the trialfarm. Pigs of each sex were initially blocked into 2weight groups then randomly assigned to either treatedor control groups, each consisting of 6 pens (2.5 m 2.5 m), of 4 pigs (2 barrows and 2 gilts) of comparabletotal starting BW. Pigs in the control group were fed abasal diet that met the NRC [9] recommendation forfinishing phase (Table 1). The treated pigs received thebasal diet supplemented with 640 mg/kg daidzein, provided by Guangdong Newland Feed Science & Technology Co., Ltd.Pigs were weighed after fasting for 12 h at the beginning and end of the 64-d finishing period to determineaverage daily gain (ADG). Feed and water were providedad libitum throughout the entire experiment period.Average daily feed intake (ADFI) for pigs was calculatedas feed offered minus feed refused every 7 d. Averagedaily gain: feed intake (G:F) was obtained based on ADGand ADFI. On d 64, heparinized blood (10 mL) was collected by jugular venipuncture from 1 gilt and 1 barrowin each pen, 4 h after feeding (1400 h). Blood was heldon ice until centrifugation (3,000 g for 15 min at 4 C),aliquots of plasma were stored at -20 C for subsequentanalysis. The blood-sampled barrows (n 6 in eachtreatment group) were then fasted for 12 h, with wateravailable, weighed on d 65 and electrically stunned andexsanguinated. Back fat, abdominal fat, liver and longissimus muscle (6/7th lumbar vertebra level) were immediately sampled, snap-frozen in liquid nitrogen, andstored at -80 C for subsequent analysis. Back fat thicknesses at the first rib, 6/7th, 10th, last rib, and the lastlumbar vertebra were measured as was longissimusmuscle area between the 10th and 11th ribs. Eye muscleareas were measured from digital images of a slice of13.40CP, %16.00Ca, %0.62P, total, %0.49P, available, %0.25Lys, %0.85Methinone, %0.24Met Cys, %0.50Thr, %0.60Trp, %0.18asupplied per kilogram of diet: 12 mg of Cu (sulfate), 150 mg of Zn (zinc oxide);120 mg of Fe (iron sulfate monohydrate), 0.7 mg of I (calcium iodate); 45 mg ofMn (manganous oxide), and 0.3 mg of Se (sodium selenite)bsupplied per kilogram of diet: 4,950 IU of vitamin A (acetate), 660 IU ofvitamin D3, 4.8 mg of vitamin K (menadione sodium bisulfate complex), 2.36mg of Vitamin E, 16.5 mg of D-pantothenic acid, 6.0 mg of riboflavin, 33.0 mgof niacin, 24.5 μg of vitamin B12, and 3.3 mg of vitamin B6longissimus muscle taken between the 10th and 11thribs.Meat quality traitsThe following meat quality measurements were made onlongissimus muscle.Loin color components and pHLoin color components and pH were assayed followingthe method of Cherel et al. [10]. The CIE L* (lightness),a* (redness), and b* (yellowness) values were determinedfrom a mean of four random readings (two readings foreach chop) at 45 min or 24 h postmortem using a Minolta chromameter CR-300 (Osaka, Japan), with a D65illuminant and a 1-cm diameter aperture. The pH at 45min, 24 h or 48 h postmortem was measured directly inlongissimus muscle (7/8th rib) using pH meter (IngoldXerolyte electrode, Knick pH-meter, Berlin, Germany).
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Page 3 of 11Drip loss, marbling score and shear forceTable 2 Oligonucleotide polymerase chain reaction primersAfter slaughter, two 2.5 cm-thick longissimus musclechops (10/11th rib) were visually evaluated for marbling(1 devoid to 10 abundant). The same day, one slicesof longissimus muscle (approximately 100 g, 9/10th ribto the last rib) were collected, trimmed of external fatand perimysium, weighed, and kept at 4 C in a plasticbag for a subsequent 45 min, 24 h or 48 h for determination of drip loss after muscle were sampled [11]. Driploss was calculated as a percentage: [(initial weight-finalweight)/initial weight] 100. According to Trefan et al.[12], shear force value (expressed in Newtons) was measured perpendicular to the axis of muscle fibers in 8 replicates for each sample.GenePrimer sense/antisenseProduct length, GGA183P450 8B1AAGGATGCGAAGAGAAAACTAGACT122Intramuscular fat determinationMuscle slices were also taken on the last rib longissimusmuscle, trimmed of external fat, minced, and freezedried before determination of intramuscular fat contentafter chloroform-methanol extraction, as described previously [13]. Lipid content of fresh tissue (g/100 g) wascalculated by taking into account the dry matter contentdetermined from the weight of minced tissue before andafter freeze-drying.AGGTGCTTGGTGCTGGCTGAof the PAB are expressed in arbitrary HK units, being thepercentage of hydrogen peroxide in the standard solution.Antioxidant enzyme activityActivities of catalase (CAT), glutathione peroxidase(GPx), and total superoxide dismutase (T-SOD), totalantioxidant capacity (T-AOC), glutathione-S-transferase(GST) and γ-glutamylcysteine synthetase (γ-GCS) inplasma or muscle homogenates were measured in duplicate using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and a plate reader.The oxidized glutathione (GSSG) and reduced glutathione(GSH) concentration in plasma were assayed according tothe kit instruction (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Supernatants, after perchloricacid extraction (muscle and liver homogenized in 4 vol 1mol/L cold acid and centrifugation) were used to measureGSSG and reduced GSH content with a kit from the samecompany. Enzyme activity, GSSG and reduced GSH content in muscle and liver were standardized against proteinconcentrations.Plasma prooxidant-antioxidant balance (PAB) assayA PAB method, slightly modified from that described byAlamdari et al. [14] was used for assay of plasma. Acetatebuffer (50 mmol/L, pH 4.5) was used instead of phosphate:citrate buffer and pure 3,3′,5,5′-tetramethylbenzidine(TMB) in dimethyl sulfoxide (DMSO) was used instead ofreagent tablets. The assay “working solution” was essentially the same and conditions for performing the assayand expressing PAB were almost identical. Full details ofthe modifications are available upon request. The valuesDetermination of tissue MDA contentThe extent of lipid oxidation in plasma, liver, longissimus muscle, backfat and abdominal fat was determinedby measuring levels of malondialdehyde (MDA), a secondary lipid oxidation product. The thiobarbituric acidmethod of Raharjo et al. [15] was used and results wereexpressed as nmol/L for plasma and nmol/mg protein insolid tissues; protein was measured by the BCA method.Isolation of RNA and real-time PCRTotal RNA was extracted from muscle, liver, backfatand abdominal fat using TRIzol reagent (Invitrogen,Carlsbad, CA, USA) according to the manufacturer’sinstructions. All RNA samples were treated withDNAase (TAKARA, Dalian, China) and were of highquality as determined by OD260:280 and evaluationTable 3 Effects of high-level supplementation with daidzein ongrowth performance in finishing pigsaControlDaidzeinInitial body weight, kg57.4557.471.060.99Final body weight, kg1101122.270.65Average weight gain, g/d91494026.40.50Average feed intake, g/d2,8713,08653.80.020.320.30bG:FaValues are means (n 6)bG:F, average weight gain:feed intakeSEMP-valueVariables0.010.15
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Page 4 of 11Fig. 1 Effects of high-level supplementation with daidzein on the thickness of backfat in finishing barrows. “*” indicates significantly different fromcontrol (P 0.05). Values are means with bars represent “SE ”, n 6after gel electrophoresis. Complementary DNA wasprepared by reverse-transcription using TAKARA RTreagents according to the manufacturer’s instructions.Real-time PCR was performed on 1 μL of cDNA product in a total volume of 20 μL containing 10 μL ofSYBR-green PCR master Mix (TAKARA, Dalian,China) and 0.2 μmol/L of gene-specific forward andreverse primers (Table 2). The following protocol wasused: denature at 95 C for 30 s, followed by 40 cyclesof 95 C for 20 s, 60 C for 30 s, and 72 C for 20s.The relative quantification of target gene expressionwas evaluated by normalizing its signal to that of βactin using 2-ΔΔCt method [16]. The fold difference inthe relative gene expression of target was calculated asthe 2-ΔΔCt value.Table 4 Changes in plasma antioxidant enzymes of finishingpigs fed a high dose of supplemental .17 0.01Gilt45.0242.960.740.23γ-GCS , U/mLbT-SODc, U/mLT-AOCd, U/mLGSTe, U/mLStatistical analysisThe results are presented as the mean SE. Bodyweight (initial and ending), ADFI, ADG and G:F wereanalyzed using one-way ANOVA. Following the methodof White et al. [17], the statistical model included dietary supplementation, replicate, and the interaction ofdietary supplementation replicate as sources of variation. Means were compared using preplanned pairwiset-test. Calculations were made using PROC MIXEDand PDIFF option (SAS Inst. Inc., Cary, NC). Drip loss,pH and color of meat were analyzed using one-wayANOVA with repeated measures. The statistical modelincluded dietary supplementation, replicate, time andall two- and three-way interactions as sources of variation. Pig with dietary supplementation replicate wasused as random variable in the model. Means were compared using a preplanned pairwise t-test. CalculationsControlVariablesfCAT , U/mLGSH/GSSGgPAB valuehaValues are means (n 6)bγ-GCS, γ-glutamylcysteine synthetase activitycT-SOD, total superoxide dismutase activitydT-AOC, total antioxidant capacityeGST, glutathione-S-transferase activityfCAT, catalase activitygGSH/GSSG, reduced glutathione/oxidized glutathionehPAB, prooxidant-antioxidant balance
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Table 5 Changes in antioxidant indicators in the longissimusmuscle of finishing barrows fed a high dose of dzeinSEMP-value0.0660.0620.0040.45GPx , U/mg pro1.161.130.270.94T-AOCd, U/mg pro0.0360.0630.010.050.810.02T-SODe, U/mg pro14.7117.56aValues are means (n 6)bGSH/GSSG, reduced glutathione/oxidized glutathionecGPx, glutathione peroxidase activitydT-AOC, total antioxidant capacityeT-SOD, total superoxide dismutase activitywere made using PROC MIXED of SAS with the REPEATED statement. The back fat was analyzed usingone-way ANOVA with repeated measures. The statistical model included dietary supplementation, replicate,backfat location and all two- and three-way interactionsas sources of variation. Means were compared usingpreplanned pairwise t-tests. Calculations were madeusing PROC MIXED of SAS, and means were separatedusing PDIFF option of SAS.ResultsAs shown in Table 3, the ADFI in pigs fed daidzein was7.5 % greater than control pigs (P 0.05). There wereno significant differences between the two groups inaverage daily gain (ADG) and G:F (Table 3). Comparedto the control animals, pigs consuming daidzein hadPage 5 of 11higher back fat thickness (P 0.05) over the first andlast ribs, and the last lumbar vertebra (Fig. 1).The antioxidant indices in plasma are summarized inTable 4. Compared with control, supplementation ofdaidzein resulted in higher activity of plasma γ-GCS inbarrows but not in gilts. The plasma activities of SOD,GST and CAT were not affected either in barrows or ingilts. The plasma PAB value in barrows fed supplementaldaidzein was approximately 35 % greater than in thecontrols (P 0.05), indicating pro-oxidant potential ofdaidzein in the circulation.As shown in Table 5, pigs fed daidzein had highermuscle SOD activity and T-AOC than those of controlanimals (P 0.05). The mRNA abundances of NADPHoxidase-2 (NOX2) and cooxygenase-2 (COX2) in longissimus muscle were significantly reduced in daidzein-fedpigs but there was no effect on expression of glutathionereductase (GR), glutamate cysteine ligase (GCL), NOX4,NOX5, COX1, 5-lipoxygenase (5-LOX), or cytochromeP450 8B1 (Fig. 2). There were no differences betweencontrols and daidzein-fed barrows in marbling score, eyemuscle areas, intramuscular fat content, shear force, driploss, pH and color (Table 6), suggesting a negligibledaidzein effect in finishing pigs on these indices of meatquality. Compared with control, pigs fed daidzein hadhigher CAT and SOD activity but had lower GSH/GSSGin liver (P 0.05, Table 7).NOX2 mRNA expression in abdominal fat was 130 %higher in daidzein-fed barrows than control (P 0.05),Fig. 2 Effects of high-level supplementation with daidzein on relative transcript abundance of anti/pro-oxidant enzyme genes in muscle offinishing barrows. “*” indicates different from control (P 0.05). Values are means, bars represent “SE”, n 6. NOX, NADPH oxidase; COX,cyclooxygenase; 5-LOX, 5-lipoxygenase; GR, glutathione reductase; GCL, glutamate cysteine ligase; P4508B1, cytochrome P-450 8B1
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Table 6 Effects of high-level supplementation with daidzein onindices of meat quality in finishing pigsaVariablesControlbDaidzeinSEMP-valueMarbling score3.253.540.210.36Eye muscle areas, cm249.9748.923.850.85Intramuscular fat, %2.231.940.360.57Shear force, Newton51.1151.072.430.9924 h1.681.690.060.8948 h2.472.350.110.4745 min6.316.350.100.7624 h5.535.500.030.5948 0.84a*16.1115.780.510.69b*3.463.190.440.70Drip loss, %pHColor45 min24 h48 haValues are means (n 6)bMarbling scores: 1 devoid to 10 moderately abundant or greatercThe L* variable represents lightness, 0 for black and 100 for white; a*represents the intensity in red; and b represents the intensity in yellowwhile there were no differences observed in NOX1,NOX4, COX1, COX2, NOX5, 5-LOX and P450 8B1(Fig. 3). The transcript abundance of both NOX2 and5-LOX in the backfat of daidzein-fed pigs was almost 2to 3 times higher than that of control (P 0.05, Fig. 4).In liver, the gene mRNA abundance of COX1 wereTable 7 Changes in antioxidant indicators in the liver offinishing barrows fed a high dose of supplemental cSEM0.03P-value0.03CAT , U/mg pro79.596.32.27 0.01T-AOCd, U/mg pro0.640.700.050.44T-SODe, U/mg pro285358aValues are means (n 6)bGSH/GSSG, reduced glutathione/oxidized glutathionecCAT, catalase activitydT-AOC, total antioxidant capacityeT-SOD, total superoxide dismutase activity16.70.01Page 6 of 11higher in daidzein-fed pigs than control (P 0.05) butNOX1 expression tended to be higher in daidzein-fedpigs (P 0.06, Fig. 5). Liver GCL mRNA abundancetended to be higher in daidzein-fed pigs than control(P 0.07, Fig. 5).Plasma concentrations of MDA in daidzein-fed barrows,but not gilts, were 190 % those of controls (P 0.01, Fig. 6).Compared with control, the daidzein-fed barrows hadhigher MDA content in liver, abdominal fat (P 0.09) andback fat (P 0.01) but had lower MDA content in longissimus muscle (P 0.05).DiscussionIn the present study, consumption of a high level of dietary daidzein increased average feed intake, but the increase did not lead to greater daily gain. Kishida et al.[18] found that dietary supplementation with compoundof daidzein and genistein resulted in reduced feed intake in female rats but not in male rats. The presentstudy has shown increased thickness of thoracic andlumbar back fat (first and the last rib and last lumbarvertebra), suggesting a stimulatory effect of daidzein onfat deposition in these finishing barrows. In 3 T3-L1cells, daidzein enhanced adipocyte differentiation andPPARγ expression in a dose-dependent manner [19],and supplementation of 50 mg/kg dietary genistein increased the weight of epididymal and renal fat pads inmale mice [20]. Other studies show quite different outcomes. Ovariectomized adult female mice, supplemented with 1500 mg/kg dietary genistein for 3 wk hadreduced fat pads and body weight, and increased apoptosis in adipose tissue [21]. Daidzein (50 mg/kg BW,i.p.) reduced short-term feed intake of rats and downregulated the fatty acid synthesis-related gene expression in adipose tissue [22]. Daidzein was also shown toinhibit the adipogenesis in mesenchymal stem cellsthrough stimulation of lipolysis [23]. Additionally, administration of 450 mg/(kg d) soy isoflavones causedreduction in the body weight and deposition of visceraladipose tissue in high-fat-diet induced insulin resistantrats [24].Reactive oxygen species (ROS) are normal metabolicproducts and play important roles in mediating cellfunction, including cell signaling [25] and protectionagainst environmental insults, both biological andchemical [25, 26]. Imbalance between ROS productionand scavenging systems results in oxidative injury toproteins, DNA, and lipids [27]. Several enzyme systemscontribute to the production of ROS, including NOX,xanthine oxidase, COX and P450 [28] while SOD, GPxand CAT are the principle antioxidant enzymes thateliminate cellular ROS, and GSH provides nonenzymatic defense [29]. These anti-and pro-oxidantsystems were evaluated here to assess the pro-oxidant
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Page 7 of 11Fig. 3 Effects of high-level supplementation with daidzein on relative transcript abundance of anti/pro-oxidant enzyme genes in liver of finishingbarrows. “*” indicates different from control (P 0.05). Values are means, bars represent “SE”, n 6. NOX, NADPH oxidase; COX, cyclooxygenase;5-LOX, 5-lipoxygenase; GR, glutathione reductase; GCL, glutamate cysteine ligase; P4508B1, cytochrome P-450 8B1Fig. 4 Effects of high-level supplementation with daidzein on relative transcript abundance of anti/pro-oxidant enzyme genes in backfat offinishing barrows. “*” indicates different from control (P 0.05). Values are means, bars represent “SE”, n 6. NOX, NADPH oxidase; COX,cyclooxygenase; 5-LOX, 5-lipoxygenase; GR, glutathione reductase; GCL, glutamate cysteine ligase; P4508B1, cytochrome P-450 8B1
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43Page 8 of 11Fig. 5 Effects of high-level supplementation with daidzein on relative transcript abundance of anti/pro-oxidant enzyme genes in abdominalfat of finishing barrows. “*” indicates different from control (P 0.05). Values are means, bars represent “SE”, n 6. NOX, NADPH oxidase; COX,cyclooxygenase; 5-LOX, 5-lipoxygenase; GR, glutathione reductase; GCL, glutamate cysteine ligase; P4508B1, cytochrome P-450 8B1potential of daidzein, at high level supplementation.The down-regulation of NOX2 and COX2 in longissimus muscle of finishing pigs was unexpected and suggests a suppressive effect of the high dose of daidzeinon the pro-oxidant system. Until now, there was nodirect evidence of daidzein influencing the NOX systemthough similar dietary supplementation with genistein(500 mg/kg) and equol (250 mg/kg) conferred neuroprotection in rats by reducing NOX activity and upregulating antioxidant genes [30]. Similarly, a moderateFig. 6 The effects of high-level dietary supplementation with daidzein on the malondialdehyde (MDA) content in various tissues of finishing pigs.MDA contents are expressed as nmol/mg protein in solid tissues and as nmol/L in plasma (B, barrows; G, gilts). Values are means (n 6), barsrepresent “SE”. “*”, “**” indicates significantly different from control (*P 0.05, **P 0.01)
Chen et al. Journal of Animal Science and Biotechnology (2016) 7:43concentration of genistein (50 or 100 μmol/L) suppressed expression of the p22phox NADPH oxidasesubunit in aortic endothelial cells from stroke-pronespontaneously hypertensive rats [31]. Consistent withthe present results, the inhibitory role of genistein inregulating NADPH oxidase was also demonstrated inhuman oral squamous carcinoma cells [32] and in adiabetic mouse model subjected to chronic i.p. treatment with genistein [33].Another ROS-producing system in oxidative stress,COX, is involved in prostaglandin synthesis [34] andCOX2 expression in muscle of the finishing pigs wasdown-regulated by high-dose supplementation withdaidzein. A major metabolite of daidzein, 7,3′,4′-trihydroxyisoflavone (THIF), inhibited ultraviolet B-inducedCOX2 expression through inhibition of nuclear factor(NF-κB) transcriptional activity in mouse epidermal JB6P cells [35]. The enhanced ROS-scavenging enzyme(SOD), as well as the suppressed ROS-inducing enzyme(NADPH oxidase and cyclooxygenase) in the muscle ofpigs fed high dose of daidzein, represents the shift towards antioxidant in the pro/antioxidant balance, whichfinally contributes to the reduced lipid peroxidation inmuscle. The present results indicate that high-dosedietary daidzein increased antioxidant enzymes inmuscle so both processes contribute to an improvedredox status. Despite this outcome, there was no overalleffect of daidzein on the meat quality.In contrast to the effects in muscle, daidzein appearedto exert pro-oxidant potential in liver, back fat and abdominal fat, based on levels of the lipid peroxidationmarker MDA in these tissues. There were significant increases in the plasma concentrations of MDA and PABvalue in just the barrows, indicating a pro-oxidant effectof the high-level supplementation with daidzein. The increased plasma activity of γ-GCS is probably a feed-backresponse to pro-oxidative effects of daidzein. The expression of NOX2 was up-regulated by daidzein both inbackfat and abdominal fat, which is contrast to that observed in muscle. Similarly, significant up-regulation ofCOX1 and NOX1 in liver as well as increased expressionof 5-LOX in backfat were also observed in the pigs fedhigh dose of daidzein. In accordance with the results,the recent report showed that high concentration ofgenistein, with similar chemical structure to daidzein,increased cellular ROS production by up-regulating5-LOX [36]. Likewise, it has been reported that LOXmediates the pro-oxidative effect of the anti-oxidantmelatonin via stimulation of arachidonic acid metabolism [37]. Lipoxygenases (LOX), an iron-containingdioxygenase, can metabolize arachidonic acid to generatea variety of bioactive eicosanoids, including prostaglandinsand leukotrienes [38]. During the catalytic cycle of LOX,peroxyl radical complexes are formed and they can servePage 9 of 11as sources of free radicals [39]. The ability of daidzein athigh dose to elicit the activation of pro-oxidant enzymesystem provides a possible mechanism to explain whylipid peroxidation occurred in fat and liver when fed highdose of daidzein. Still it could not be excluded that thepro-oxidant function may be mediated through its metabolism because it is reported that 7,3′,4′-trihydroxyisoflavone (7,3′,4′-THIF), one of the major metabolitesof daidzein was able to increase the ROS production inhuman cervical cancer cells [40]. The results of thisstudy indicate that daidzein supplementation led to proor anti-oxidant effects in a tissue-dependent manner.The biological actions of isoflavones vary, dependingupon their concentrations. Low concentrations enhancethe antioxidant system [3, 4] and protect cells againstoxidative stress [41, 42] while high concentrations maycause oxidative injury, such as DNA damage and celldeath [36, 43]. The basis for the different effects of daidzein in muscle from other tissues, shown here, is notknown but might reflect differential daidzein uptake orsensitivity in the various tissues, possibly related to itslipid solubility.ConclusionIn summary, this study has demonstrated that high-levelsupplementation of a corn-soybean meal diet with daidzein enhances the redox system in the longissimusmuscle of finishing pigs by down-regulating the prooxidant system and is without effect on indices of meatquality. At the same time, pro-oxidant responses wereapparent in liver and fat tissue, suggesting that tissuedependent actions existed.Abbreviations5-LOX, 5-lipoxygenase; CAT, catalase; COX, cyclooxygenase; DMSO, dimethylsulfoxide; GCL, glutamate cysteine ligase; GPx, glutathione peroxidase; GR,glutathione reductase;
Loin color components and pH Loin color components and pH were assayed following the method of Cherel et al. [10]. The CIE L* (lightness), a* (redness), and b* (yellowness) values were determined from a mean of four random readings (two readings for each chop) at 45 min or 24 h postmortem using a Min-olta chromameter CR-300 (Osaka, Japan), with .
were conducted in participants at high risk of CVD, two trials examined CoQ10 supplementation alone and four examined CoQ10 supplementation in patients on statin therapy; we analysed these separately. All six trials were small-scale, recruiting between 20 and Co-enzyme Q10 supplementation for the primary prevention of cardiovascular disease .
The Role of Enzyme Supplementation in Digestive Disorders. Abstract This article reviews various forms of enzyme supplementation . used clinically in digestive and absorption disorders. Enzyme supplementation plays an integral role in the management of various digestive disorders, particularly with regard to exocrine pancreatic insufficiency.
the strategic supplementation of bypass LO can enhance reproductive indexes—fertility, lambing rate, and prolificacy—in dairy Sarda ewes at the end of lactation. To assess whether LO supplementation leads to the adsorptions of PUFAs and their subsequent utilization by the body tissues, milk composition and fatty acid content were analyzed. 2.
U.S. Dietary Guidelines Low Awareness Barriers to Adoption and Use High Skepticism About 50 % of Americans are aware of the Dietary Guidelines*; just 1 in 10 know what they say* 33% call the Dietary Guidelines ―complicated‖* Just 18% say the Dietary Guidelines influen
Effects of dietary enzyme supplementation on performance, bone ash, small intestinal morphology, and apparent ileal amino acid digestibility of broilers exposed to a live coccidia oocyst vaccine Carrie L. Walk Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in
Texas Department of Agriculture — November 2011 Accommodating Children with Special Dietary Needs 13.a Accommodating Children With Special Dietary Needs—Table of Contents Special Dietary Needs 13.1 Definitions of Disability and of Other Special Dietary Needs 13.2 Individuals With Disabilities Education Act 13.2 Physician’s Statement for Children With Disabilities
Dietary Guidelines Advisory Committee. 2010. Report of the Dietary Guidelines Advisory Committee on the Dietary Guidelines for Americans, 2010, to the Secretary of Agriculture and the Secretary of Health and Human Services. U.S. Department of Agriculture
(HHS/USDA) 2005 Dietary Guidelines for Americans Dietary Guidelines for Americans (USDA/HHS) 2010 McGovern Report - Dietary Goals (6) 1977 Surgeon General's Report on Health Promotion 1979 Dietary Guidelines for Americans (USDA/HH
